Transcript: Human XM_005260579.4

PREDICTED: Homo sapiens cytochrome c oxidase subunit 4I2 (COX4I2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COX4I2 (84701)
Length:
698
CDS:
63..593

Additional Resources:

NCBI RefSeq record:
XM_005260579.4
NBCI Gene record:
COX4I2 (84701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260579.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046169 GATTCGCAGCTCTGGTGATTT pLKO.1 418 CDS 100% 13.200 9.240 N COX4I2 n/a
2 TRCN0000046172 GCCCTTCTGCACAGAACTCAA pLKO.1 230 CDS 100% 4.950 3.465 N COX4I2 n/a
3 TRCN0000046168 GCTCCAGTTCAATGAGACCTT pLKO.1 332 CDS 100% 2.640 1.848 N COX4I2 n/a
4 TRCN0000046171 CCGTCGCTCCAATGAGTGGAA pLKO.1 365 CDS 100% 0.880 0.616 N COX4I2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260579.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04416 pDONR223 100% 85% 78.3% None (many diffs) n/a
2 ccsbBroad304_04416 pLX_304 0% 85% 78.3% V5 (many diffs) n/a
3 TRCN0000477531 GCGGAGATACGACCCTACCACACC pLX_317 62.3% 84.8% 77.7% V5 (many diffs) n/a
Download CSV