Transcript: Human XM_005260935.1

PREDICTED: Homo sapiens ETS proto-oncogene 2, transcription factor (ETS2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETS2 (2114)
Length:
3839
CDS:
364..1773

Additional Resources:

NCBI RefSeq record:
XM_005260935.1
NBCI Gene record:
ETS2 (2114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013918 GCCGACTAAGAGAAGTTGTAA pLKO.1 2411 3UTR 100% 5.625 7.875 N ETS2 n/a
2 TRCN0000013922 CGCCAACTGTGAATTGCCTTT pLKO.1 552 CDS 100% 4.050 3.240 N ETS2 n/a
3 TRCN0000424904 GAATCCCTTAACAGTTGTATT pLKO_005 2259 3UTR 100% 13.200 9.240 N ETS2 n/a
4 TRCN0000425122 GAGCAAGGCAAACCAGTTATA pLKO_005 1390 CDS 100% 13.200 9.240 N ETS2 n/a
5 TRCN0000013919 CCTGACTTTGTGGGTGACATT pLKO.1 817 CDS 100% 4.950 3.465 N ETS2 n/a
6 TRCN0000013920 GCTGTGATGAGTCAAGCCTTA pLKO.1 592 CDS 100% 4.050 2.835 N ETS2 n/a
7 TRCN0000013921 CCAACCATGTCTTTCAAGGAT pLKO.1 1342 CDS 100% 3.000 2.100 N ETS2 n/a
8 TRCN0000233984 GAGCAAGGCAAACCAGTTATT pLKO_005 1390 CDS 100% 13.200 9.240 N Ets2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479087 TGGCCAACTACGCTCAGCCGATGA pLX_317 28.8% 99.8% 100% V5 816T>G;1023A>G n/a
2 ccsbBroadEn_10428 pDONR223 100% 99.6% 99.5% None (many diffs) n/a
3 ccsbBroad304_10428 pLX_304 0% 99.6% 99.5% V5 (many diffs) n/a
4 ccsbBroadEn_15411 pDONR223 0% 99.7% 100% None 816T>G;1023A>G;1395C>A n/a
5 ccsbBroad304_15411 pLX_304 0% 99.7% 100% V5 816T>G;1023A>G;1395C>A n/a
6 TRCN0000491545 ATACGAGACTGAATGCTTGTGCGC pLX_317 21.6% 99.7% 100% V5 816T>G;1023A>G;1395C>A n/a
Download CSV