Transcript: Human XM_005261315.2

PREDICTED: Homo sapiens transducer of ERBB2, 2 (TOB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOB2 (10766)
Length:
5772
CDS:
1919..2953

Additional Resources:

NCBI RefSeq record:
XM_005261315.2
NBCI Gene record:
TOB2 (10766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265689 TGGGTCGCAAGTCCTTATTTA pLKO_005 3852 3UTR 100% 15.000 21.000 N TOB2 n/a
2 TRCN0000255821 TTGACATGGCCCAGGTATTTG pLKO_005 2814 CDS 100% 13.200 18.480 N TOB2 n/a
3 TRCN0000004167 CGGCCTGTGATTTATTTGGTT pLKO.1 3161 3UTR 100% 3.000 2.400 N TOB2 n/a
4 TRCN0000255820 TTGAGGTGTCCTACCAGATTG pLKO_005 2208 CDS 100% 10.800 7.560 N TOB2 n/a
5 TRCN0000004165 GAGCTGAGTGTCTGGATTGAT pLKO.1 2183 CDS 100% 5.625 3.938 N TOB2 n/a
6 TRCN0000004166 AGAGCTGGACAAGGAGATCAA pLKO.1 2287 CDS 100% 4.950 3.465 N TOB2 n/a
7 TRCN0000004164 CTGGCTTCCGCTGTGTTCACA pLKO.1 2076 CDS 100% 1.000 0.700 N TOB2 n/a
8 TRCN0000255823 TCCTTCGCTGCCACCAAATTT pLKO_005 2456 CDS 100% 15.000 9.000 N TOB2 n/a
9 TRCN0000255822 TCCTGGAGAAGACACCCTTTG pLKO_005 2856 CDS 100% 6.000 3.600 N TOB2 n/a
10 TRCN0000313176 GCCTCAGCTACAACCTGAATA pLKO_005 2883 CDS 100% 13.200 7.920 N Tob2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10327 pDONR223 100% 31.1% 23.9% None (many diffs) n/a
2 ccsbBroad304_10327 pLX_304 0% 31.1% 23.9% V5 (many diffs) n/a
3 TRCN0000467527 TCTGGTGTTCCCCGCCCAAACTCA pLX_317 98.4% 31.1% 23.9% V5 (many diffs) n/a
Download CSV