Transcript: Human XM_005261638.4

PREDICTED: Homo sapiens phosphomannomutase 1 (PMM1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMM1 (5372)
Length:
1153
CDS:
235..732

Additional Resources:

NCBI RefSeq record:
XM_005261638.4
NBCI Gene record:
PMM1 (5372)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049064 CGGCTCTGACTACTGTAAGAT pLKO.1 191 5UTR 100% 5.625 7.875 N PMM1 n/a
2 TRCN0000414558 AGAGTTTGGCCTAGGCCTAAA pLKO_005 766 3UTR 100% 10.800 8.640 N PMM1 n/a
3 TRCN0000434366 TGCAGCGATGCCGGGAGATTT pLKO_005 683 CDS 100% 4.400 3.520 N PMM1 n/a
4 TRCN0000442113 GCCACAGCTGCTGCTTGTATT pLKO_005 970 3UTR 100% 13.200 9.240 N PMM1 n/a
5 TRCN0000428849 ACTTCTTTGGGAACGAGACTA pLKO_005 584 CDS 100% 4.950 3.465 N PMM1 n/a
6 TRCN0000049066 CGAACTGGACAAGAAAGAGAA pLKO.1 405 CDS 100% 4.950 3.465 N PMM1 n/a
7 TRCN0000416140 GAATGGCATGCTGAACATCTC pLKO_005 339 CDS 100% 4.050 2.835 N PMM1 n/a
8 TRCN0000049063 GCTACGAAGTAGAGTGCAGAT pLKO.1 158 5UTR 100% 4.050 2.835 N PMM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01227 pDONR223 100% 62.9% 50.7% None 0_1ins199;82_83ins92 n/a
2 ccsbBroad304_01227 pLX_304 0% 62.9% 50.7% V5 0_1ins199;82_83ins92 n/a
3 TRCN0000469573 TCTGTGGTAGCATGCATCGGGCCT pLX_317 57% 62.9% 50.7% V5 0_1ins199;82_83ins92 n/a
Download CSV