Transcript: Human XM_005261798.1

PREDICTED: Homo sapiens THO complex 5 (THOC5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THOC5 (8563)
Length:
2592
CDS:
218..2302

Additional Resources:

NCBI RefSeq record:
XM_005261798.1
NBCI Gene record:
THOC5 (8563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000112 ATCCTGACTTTGAGCGACTAT pLKO.1 1529 CDS 100% 4.950 6.930 N THOC5 n/a
2 TRCN0000272542 ATCCTGACTTTGAGCGACTAT pLKO_005 1529 CDS 100% 4.950 6.930 N THOC5 n/a
3 TRCN0000272603 CCCACATGTGACTCTTGATAT pLKO_005 2372 3UTR 100% 13.200 9.240 N THOC5 n/a
4 TRCN0000000111 CCAGCCAATCAGTATCAGTTT pLKO.1 1496 CDS 100% 4.950 3.465 N THOC5 n/a
5 TRCN0000272543 CCAGCCAATCAGTATCAGTTT pLKO_005 1496 CDS 100% 4.950 3.465 N THOC5 n/a
6 TRCN0000000113 CTACAGAAGGAGATCACCAAA pLKO.1 635 CDS 100% 4.950 3.465 N THOC5 n/a
7 TRCN0000272544 TACCGAGAGTGCCTATCTAAC pLKO_005 830 CDS 100% 0.000 0.000 N THOC5 n/a
8 TRCN0000000114 GATGTGGCAATAGAAATAGAA pLKO.1 452 CDS 100% 5.625 3.375 N THOC5 n/a
9 TRCN0000284792 GATGTGGCAATAGAAATAGAA pLKO_005 452 CDS 100% 5.625 3.375 N THOC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07264 pDONR223 99.5% 98.3% 98.1% None 847_879del;1606G>A;1768G>A n/a
2 ccsbBroad304_07264 pLX_304 0% 98.3% 98.1% V5 (not translated due to prior stop codon) 847_879del;1606G>A;1768G>A n/a
Download CSV