Transcript: Human XM_005261914.4

PREDICTED: Homo sapiens DENN domain containing 6B (DENND6B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND6B (414918)
Length:
2108
CDS:
28..1932

Additional Resources:

NCBI RefSeq record:
XM_005261914.4
NBCI Gene record:
DENND6B (414918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122293 CCTAAGCAAGTCAAGCTGAAA pLKO.1 1255 CDS 100% 4.950 3.960 N DENND6B n/a
2 TRCN0000122162 GAGTCACAAACCCTTTCTTTA pLKO.1 1169 CDS 100% 13.200 9.240 N DENND6B n/a
3 TRCN0000184022 CGAAGCAGTTTGACCAAGAGA pLKO.1 857 CDS 100% 3.000 2.100 N DENND6B n/a
4 TRCN0000184671 CCTGAAACTTCGTGAGAAGCT pLKO.1 1788 CDS 100% 2.640 1.848 N DENND6B n/a
5 TRCN0000184318 GCTGACTCATATGCAGACACT pLKO.1 948 CDS 100% 0.000 0.000 N DENND6B n/a
6 TRCN0000184193 GAACATCGAGACCTGGATGAA pLKO.1 1734 CDS 100% 4.950 2.970 N DENND6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10154 pDONR223 100% 92.2% 92.1% None 4G>T;452_598del n/a
2 ccsbBroad304_10154 pLX_304 0% 92.2% 92.1% V5 4G>T;452_598del n/a
3 TRCN0000481297 CCTCCCTGTAGCTGTAGCCGACGT pLX_317 25% 92.2% 92.1% V5 4G>T;452_598del n/a
Download CSV