Transcript: Human XM_005261986.4

PREDICTED: Homo sapiens fatty acid amide hydrolase 2 (FAAH2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAAH2 (158584)
Length:
1234
CDS:
127..1167

Additional Resources:

NCBI RefSeq record:
XM_005261986.4
NBCI Gene record:
FAAH2 (158584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418471 ACTAGACACAAAGGTACATTT pLKO_005 1011 CDS 100% 13.200 18.480 N FAAH2 n/a
2 TRCN0000424269 GCCGAGCAGCTTTAGTCTTAG pLKO_005 200 CDS 100% 10.800 15.120 N FAAH2 n/a
3 TRCN0000412592 GAACATGATGGAGGCTCATTT pLKO_005 1057 CDS 100% 13.200 9.240 N FAAH2 n/a
4 TRCN0000427844 ACTGGTCCTATGTGCCGTTAT pLKO_005 931 CDS 100% 10.800 7.560 N FAAH2 n/a
5 TRCN0000148608 CAACAGAATCAAGGACGTGAA pLKO.1 351 CDS 100% 4.050 2.835 N FAAH2 n/a
6 TRCN0000183062 CCCATATGATTTACAGCATAT pLKO.1 711 CDS 100% 0.000 0.000 N FAAH2 n/a
7 TRCN0000148211 GTATAGATGTTGTTCAGGCTT pLKO.1 326 CDS 100% 2.640 1.584 N FAAH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09725 pDONR223 100% 63.9% 62.9% None (many diffs) n/a
2 ccsbBroad304_09725 pLX_304 0% 63.9% 62.9% V5 (many diffs) n/a
3 TRCN0000467435 GAACTTAAGGTCCAATAAACACGT pLX_317 16.5% 63.9% 62.9% V5 (many diffs) n/a
Download CSV