Transcript: Human XM_005262000.1

PREDICTED: Homo sapiens PHD finger protein 8 (PHF8), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF8 (23133)
Length:
4615
CDS:
360..3314

Additional Resources:

NCBI RefSeq record:
XM_005262000.1
NBCI Gene record:
PHF8 (23133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118318 CGACCCTGATAATAAGACCAA pLKO.1 2053 CDS 100% 2.640 3.696 N PHF8 n/a
2 TRCN0000118319 CGAACCGTACAGCTCATTAAA pLKO.1 1740 CDS 100% 15.000 12.000 N PHF8 n/a
3 TRCN0000118320 GCGAACCGTACAGCTCATTAA pLKO.1 1739 CDS 100% 13.200 9.240 N PHF8 n/a
4 TRCN0000118321 CCCAACTGTGAAGTCTTGCAT pLKO.1 618 CDS 100% 3.000 2.100 N PHF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02723 pDONR223 100% 85% 85% None 1_108del;1431_1432ins303;2877_2952delinsG n/a
2 ccsbBroad304_02723 pLX_304 0% 85% 85% V5 1_108del;1431_1432ins303;2877_2952delinsG n/a
3 TRCN0000476068 ATATTTCACCATCGGTATTGCCGT pLX_317 8.8% 85% 85% V5 1_108del;1431_1432ins303;2877_2952delinsG n/a
Download CSV