Transcript: Human XM_005262079.3

PREDICTED: Homo sapiens family with sequence similarity 199, X-linked (FAM199X), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM199X (139231)
Length:
7240
CDS:
79..1116

Additional Resources:

NCBI RefSeq record:
XM_005262079.3
NBCI Gene record:
FAM199X (139231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417333 ATTGGTCAGATAGCGAGTTTG pLKO_005 467 CDS 100% 10.800 15.120 N FAM199X n/a
2 TRCN0000426024 GATGAGCAGGTGGAATATATT pLKO_005 637 CDS 100% 15.000 10.500 N Fam199x n/a
3 TRCN0000420940 TCTGATGCACAGTCTAGTTTA pLKO_005 1393 3UTR 100% 13.200 9.240 N FAM199X n/a
4 TRCN0000418467 TGATGTAATAAGGGTGAATTT pLKO_005 1109 CDS 100% 13.200 9.240 N FAM199X n/a
5 TRCN0000138109 GCCTGGAAGAGAAGCAACTTT pLKO.1 859 CDS 100% 5.625 3.938 N FAM199X n/a
6 TRCN0000136186 GAACTTAACTGTCTCACAGAT pLKO.1 772 CDS 100% 4.950 3.465 N FAM199X n/a
7 TRCN0000427592 GAACTTAACTGTCTCACAGAT pLKO_005 772 CDS 100% 4.950 3.465 N Fam199x n/a
8 TRCN0000137069 CCTGTTAGATGATCAGGACTT pLKO.1 375 CDS 100% 4.050 2.835 N FAM199X n/a
9 TRCN0000135449 GAAGCAACTTTAGTTGTGCAA pLKO.1 869 CDS 100% 2.640 1.848 N FAM199X n/a
10 TRCN0000137719 GCTGTCCTTGAAAGTGACTGA pLKO.1 1059 CDS 100% 2.640 1.848 N FAM199X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09581 pDONR223 100% 88.8% 88.6% None 7G>A;867_868ins129 n/a
2 ccsbBroad304_09581 pLX_304 0% 88.8% 88.6% V5 7G>A;867_868ins129 n/a
3 TRCN0000481313 ACTTTATGTAATGCCGTTCGTAAT pLX_317 35.2% 88.8% 88.6% V5 7G>A;867_868ins129 n/a
Download CSV