Transcript: Human XM_005262821.4

PREDICTED: Homo sapiens coagulation factor XI (F11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
F11 (2160)
Length:
4327
CDS:
334..2214

Additional Resources:

NCBI RefSeq record:
XM_005262821.4
NBCI Gene record:
F11 (2160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372203 TTGCCCAGTACACGCATTAAA pLKO_005 1123 CDS 100% 15.000 21.000 N F11 n/a
2 TRCN0000372148 AGAATAACGAAGCTCGATAAA pLKO_005 862 CDS 100% 13.200 18.480 N F11 n/a
3 TRCN0000006796 CGGGTATGATATTGCCTTGTT pLKO.1 1767 CDS 100% 4.950 6.930 N F11 n/a
4 TRCN0000372202 CTAGACATGAAGGGCATAAAC pLKO_005 685 CDS 100% 13.200 9.240 N F11 n/a
5 TRCN0000006795 GCCCAAAGAATCTCAAAGAAA pLKO.1 1071 CDS 100% 5.625 3.938 N F11 n/a
6 TRCN0000006794 GCCTTCCAAAGGAGATAGAAA pLKO.1 1839 CDS 100% 5.625 3.938 N F11 n/a
7 TRCN0000006793 CCACCCAAGATGTTTACTCTT pLKO.1 489 CDS 100% 4.950 3.465 N F11 n/a
8 TRCN0000006792 GCCATTGGAGTCCCTGAAGGA pLKO.1 2229 3UTR 100% 0.880 0.616 N F11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00532 pDONR223 100% 99.8% 99.6% None 1029_1031delCAG n/a
2 ccsbBroad304_00532 pLX_304 0% 99.8% 99.6% V5 1029_1031delCAG n/a
3 TRCN0000472376 TGTGGCCACCCTCCAAGCTGCCTG pLX_317 22.9% 99.8% 99.6% V5 1029_1031delCAG n/a
Download CSV