Transcript: Human XM_005262885.3

PREDICTED: Homo sapiens ELMO domain containing 2 (ELMOD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELMOD2 (255520)
Length:
4758
CDS:
446..1363

Additional Resources:

NCBI RefSeq record:
XM_005262885.3
NBCI Gene record:
ELMOD2 (255520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262885.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128316 GAAATGGCTATTACGACAGAT pLKO.1 535 CDS 100% 4.950 6.930 N ELMOD2 n/a
2 TRCN0000129933 GATGGCTTATAGCTTACTGAA pLKO.1 1120 CDS 100% 4.950 6.930 N ELMOD2 n/a
3 TRCN0000130858 GCGAACTACAGTTTGGAACTT pLKO.1 1593 3UTR 100% 4.950 6.930 N ELMOD2 n/a
4 TRCN0000128010 GAAGTGTGAATTGCAGCGAAT pLKO.1 562 CDS 100% 4.050 5.670 N ELMOD2 n/a
5 TRCN0000422559 TTAGGGTATTCTTATGCAATA pLKO_005 1079 CDS 100% 10.800 8.640 N ELMOD2 n/a
6 TRCN0000429452 CAGATTCTTTCCCGTTCAAAT pLKO_005 1049 CDS 100% 13.200 9.240 N ELMOD2 n/a
7 TRCN0000127929 CATGGGCATACTTGGGTTAAT pLKO.1 985 CDS 100% 13.200 9.240 N ELMOD2 n/a
8 TRCN0000422620 CTGATCAATTACACTCTTATA pLKO_005 1438 3UTR 100% 13.200 9.240 N ELMOD2 n/a
9 TRCN0000412721 GAAGCTTTGGAATCTTCTAAT pLKO_005 877 CDS 100% 13.200 9.240 N ELMOD2 n/a
10 TRCN0000424743 GGACAAATATGTAGATGATAT pLKO_005 691 CDS 100% 13.200 9.240 N ELMOD2 n/a
11 TRCN0000425194 TACTGCAGATAACTGGTTATA pLKO_005 777 CDS 100% 13.200 9.240 N ELMOD2 n/a
12 TRCN0000129706 CGAAGAAGTTAAACGCTAGAA pLKO.1 903 CDS 100% 4.950 3.465 N ELMOD2 n/a
13 TRCN0000128370 GCAGCGAATATTTGATACCTA pLKO.1 574 CDS 100% 3.000 2.100 N ELMOD2 n/a
14 TRCN0000130714 GCTTACTGAAGAGTGAAGCTT pLKO.1 1131 CDS 100% 3.000 2.100 N ELMOD2 n/a
15 TRCN0000127901 CCACGAAGAAGTTAAACGCTA pLKO.1 900 CDS 100% 2.640 1.848 N ELMOD2 n/a
16 TRCN0000128502 GATTCTGATAACCTACAGCAT pLKO.1 842 CDS 100% 2.640 1.848 N ELMOD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262885.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14453 pDONR223 100% 95.9% 2.6% None 1_36del;48delT n/a
2 ccsbBroad304_14453 pLX_304 0% 95.9% 2.6% V5 (not translated due to prior stop codon) 1_36del;48delT n/a
3 TRCN0000469152 CGCTACCGTTGCTGATTCCTCCAA pLX_317 45.1% 95.9% 2.6% V5 (not translated due to prior stop codon) 1_36del;48delT n/a
Download CSV