Transcript: Human XM_005262898.3

PREDICTED: Homo sapiens major facilitator superfamily domain containing 8 (MFSD8), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD8 (256471)
Length:
3143
CDS:
78..1088

Additional Resources:

NCBI RefSeq record:
XM_005262898.3
NBCI Gene record:
MFSD8 (256471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151880 CTAAAGCTCTGCTAGACAATT pLKO.1 2267 3UTR 100% 13.200 18.480 N MFSD8 n/a
2 TRCN0000151904 CTTGCCATACTAAGAGAACAT pLKO.1 762 CDS 100% 4.950 6.930 N MFSD8 n/a
3 TRCN0000152991 GCATGTGTCAAGCATTAGGTT pLKO.1 595 CDS 100% 3.000 4.200 N MFSD8 n/a
4 TRCN0000152821 GATCATATACTGCTGGTGCTA pLKO.1 535 CDS 100% 2.640 3.696 N MFSD8 n/a
5 TRCN0000154785 GCTGGTTAACAGCATCTGGAA pLKO.1 2024 3UTR 100% 2.640 3.696 N MFSD8 n/a
6 TRCN0000152231 CTAAGACTGTGATGGAAACTA pLKO.1 2223 3UTR 100% 5.625 4.500 N MFSD8 n/a
7 TRCN0000151791 CTTCATATAGTCTTGGCCAAA pLKO.1 319 CDS 100% 4.050 3.240 N MFSD8 n/a
8 TRCN0000101127 GCTGGGTTATTGCTTCATATA pLKO.1 307 CDS 100% 13.200 9.240 N Mfsd8 n/a
9 TRCN0000152401 GCTGGGTTATTGCTTCATATA pLKO.1 307 CDS 100% 13.200 9.240 N MFSD8 n/a
10 TRCN0000353713 GCTGGGTTATTGCTTCATATA pLKO_005 307 CDS 100% 13.200 9.240 N MFSD8 n/a
11 TRCN0000152643 GCTAAGACTGTGATGGAAACT pLKO.1 2222 3UTR 100% 4.950 3.465 N MFSD8 n/a
12 TRCN0000353714 GCTAAGACTGTGATGGAAACT pLKO_005 2222 3UTR 100% 4.950 3.465 N MFSD8 n/a
13 TRCN0000150933 GTCTGCAATCTTATGTCCTAT pLKO.1 1267 3UTR 100% 4.950 3.465 N MFSD8 n/a
14 TRCN0000154715 GCCAAATGGTAGCTTCACCTA pLKO.1 334 CDS 100% 2.640 1.848 N MFSD8 n/a
15 TRCN0000331075 GCCAAATGGTAGCTTCACCTA pLKO_005 334 CDS 100% 2.640 1.848 N MFSD8 n/a
16 TRCN0000331019 GAGCCGATGGAGATCTATTAG pLKO_005 176 CDS 100% 13.200 7.920 N MFSD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05315 pDONR223 100% 64.5% 64.2% None (many diffs) n/a
2 ccsbBroad304_05315 pLX_304 0% 64.5% 64.2% V5 (many diffs) n/a
3 TRCN0000467555 GGCCCTGGCTTGCGGGGCCACTGT pLX_317 25.7% 64.5% 64.2% V5 (many diffs) n/a
Download CSV