Transcript: Human XM_005263082.3

PREDICTED: Homo sapiens tet methylcytosine dioxygenase 2 (TET2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TET2 (54790)
Length:
9437
CDS:
145..6153

Additional Resources:

NCBI RefSeq record:
XM_005263082.3
NBCI Gene record:
TET2 (54790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418976 TTTCACGCCAAGTCGTTATTT pLKO_005 3247 CDS 100% 15.000 21.000 N TET2 n/a
2 TRCN0000421134 CAGATGCACAGGCCAATTAAG pLKO_005 3070 CDS 100% 13.200 9.240 N TET2 n/a
3 TRCN0000144344 CCTTATAGTCAGACCATGAAA pLKO.1 2596 CDS 100% 5.625 3.938 N TET2 n/a
4 TRCN0000139778 CCTCAAGCATAACCCACCAAT pLKO.1 1677 CDS 100% 4.950 3.465 N TET2 n/a
5 TRCN0000192770 CCAACTCATGGGTCAATTCTT pLKO.1 5740 CDS 100% 5.625 3.938 N Tet2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12083 pDONR223 100% 30.7% 30.6% None 1_4161del;5284A>G n/a
2 ccsbBroad304_12083 pLX_304 0% 30.7% 30.6% V5 1_4161del;5284A>G n/a
3 TRCN0000472069 TGGTGTGATTGTGCTCGTGCATTG pLX_317 8.3% 30.7% 30.6% V5 1_4161del;5284A>G n/a
Download CSV