Transcript: Human XM_005263854.5

PREDICTED: Homo sapiens actin related protein 1B (ACTR1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACTR1B (10120)
Length:
2012
CDS:
214..1122

Additional Resources:

NCBI RefSeq record:
XM_005263854.5
NBCI Gene record:
ACTR1B (10120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263854.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116308 CCGATTACTCAGTGAAGTGAA pLKO.1 927 CDS 100% 4.950 6.930 N ACTR1B n/a
2 TRCN0000315660 CCGATTACTCAGTGAAGTGAA pLKO_005 927 CDS 100% 4.950 6.930 N ACTR1B n/a
3 TRCN0000116310 TCCCGTGCTATTCATCGCAAA pLKO.1 1093 CDS 100% 4.050 5.670 N ACTR1B n/a
4 TRCN0000315727 TCCCGTGCTATTCATCGCAAA pLKO_005 1093 CDS 100% 4.050 5.670 N ACTR1B n/a
5 TRCN0000116311 AGGAGACCAGATTCCCAAATA pLKO.1 145 5UTR 100% 13.200 9.240 N ACTR1B n/a
6 TRCN0000315659 AGGAGACCAGATTCCCAAATA pLKO_005 145 5UTR 100% 13.200 9.240 N ACTR1B n/a
7 TRCN0000116309 CAGTACGTCTACTCCAAGGAT pLKO.1 262 CDS 100% 3.000 2.100 N ACTR1B n/a
8 TRCN0000349130 CAGTACGTCTACTCCAAGGAT pLKO_005 262 CDS 100% 3.000 2.100 N ACTR1B n/a
9 TRCN0000116307 GCCACTTAATAAGGAGTCAGA pLKO.1 1828 3UTR 100% 2.640 1.848 N ACTR1B n/a
10 TRCN0000315728 GCCACTTAATAAGGAGTCAGA pLKO_005 1828 3UTR 100% 2.640 1.848 N ACTR1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263854.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07555 pDONR223 100% 80.2% 80.3% None 0_1ins222;582C>G n/a
2 ccsbBroad304_07555 pLX_304 0% 80.2% 80.3% V5 0_1ins222;582C>G n/a
3 TRCN0000465969 GCCACCGGCCCCGTCGATTCAGTA pLX_317 38.1% 80.2% 80.3% V5 0_1ins222;582C>G n/a
4 ccsbBroadEn_07554 pDONR223 100% 80.1% 80% None 0_1ins222;56T>C;582C>G n/a
5 ccsbBroad304_07554 pLX_304 0% 80.1% 80% V5 0_1ins222;56T>C;582C>G n/a
6 TRCN0000471351 ATAATAAATACATTTACAGATCGA pLX_317 45.1% 80.1% 80% V5 0_1ins222;56T>C;582C>G n/a
Download CSV