Transcript: Human XM_005263876.3

PREDICTED: Homo sapiens tektin 4 (TEKT4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEKT4 (150483)
Length:
1354
CDS:
148..1095

Additional Resources:

NCBI RefSeq record:
XM_005263876.3
NBCI Gene record:
TEKT4 (150483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431482 AGACAAGATGGAGGCCTACAA pLKO_005 759 CDS 100% 4.950 3.465 N TEKT4 n/a
2 TRCN0000438384 CCAAGTTCACGCAGGACAATC pLKO_005 884 CDS 100% 10.800 6.480 N TEKT4 n/a
3 TRCN0000180959 GAGTGGTTCCAGAACTGCTAT pLKO.1 274 CDS 100% 4.950 2.970 N TEKT4 n/a
4 TRCN0000180387 GCTGCTGAAGAGAACCATCAT pLKO.1 675 CDS 100% 4.950 2.970 N TEKT4 n/a
5 TRCN0000444027 AGCTGAACATGTCCCTCACAG pLKO_005 1104 3UTR 100% 4.050 2.430 N TEKT4 n/a
6 TRCN0000430231 CCGAGCTCATCCGGAACATTC pLKO_005 650 CDS 100% 3.600 2.160 N TEKT4 n/a
7 TRCN0000180524 GCTGAAGAGAACCATCATGCA pLKO.1 678 CDS 100% 2.640 1.584 N TEKT4 n/a
8 TRCN0000180024 CTTCTCCATCACCACTGACAA pLKO.1 555 CDS 100% 4.950 2.475 Y TEKT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05043 pDONR223 100% 71.9% 71.7% None (many diffs) n/a
2 ccsbBroad304_05043 pLX_304 0% 71.9% 71.7% V5 (many diffs) n/a
3 TRCN0000465345 ACAAAGGCTTGAAGTAACCCCAAC pLX_317 27.6% 71.9% 71.7% V5 (many diffs) n/a
Download CSV