Transcript: Human XM_005264100.3

PREDICTED: Homo sapiens SIX homeobox 2 (SIX2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIX2 (10736)
Length:
2402
CDS:
536..1417

Additional Resources:

NCBI RefSeq record:
XM_005264100.3
NBCI Gene record:
SIX2 (10736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014645 GAGCACCTTCACAAGAATGAA pLKO.1 656 CDS 100% 5.625 7.875 N SIX2 n/a
2 TRCN0000014647 ACACTACATCGAGGCGGAGAA pLKO.1 805 CDS 100% 4.050 5.670 N SIX2 n/a
3 TRCN0000433131 GACGCCAGACCACTCATCATC pLKO_005 1201 CDS 100% 1.650 2.310 N SIX2 n/a
4 TRCN0000414036 GTTCTTGTTTGGGATTTATTT pLKO_005 1579 3UTR 100% 15.000 10.500 N SIX2 n/a
5 TRCN0000014644 CAACGAGAACTCCAATTCTAA pLKO.1 1108 CDS 100% 5.625 3.938 N SIX2 n/a
6 TRCN0000014646 CCCGCTGAATGGCAGCGGCAA pLKO.1 1138 CDS 100% 0.000 0.000 N SIX2 n/a
7 TRCN0000413841 CAACTTCCGCGAGCTCTACAA pLKO_005 718 CDS 100% 4.950 2.970 N Six2 n/a
8 TRCN0000014643 CCTTTCCTCTTCCTTTCCCTT pLKO.1 1737 3UTR 100% 2.640 1.584 N SIX2 n/a
9 TRCN0000312789 TCCGCGAGCTCTACAAGATAC pLKO_005 723 CDS 100% 10.800 6.480 N Six1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07671 pDONR223 100% 99.2% 98.9% None 472G>A;561_566delGTACGA n/a
2 ccsbBroad304_07671 pLX_304 0% 99.2% 98.9% V5 472G>A;561_566delGTACGA n/a
3 TRCN0000467949 TCAACACTCCCATCGGCATACTCT pLX_317 43.7% 99.2% 98.9% V5 472G>A;561_566delGTACGA n/a
Download CSV