Transcript: Human XM_005264175.5

PREDICTED: Homo sapiens DNA methyltransferase 3 alpha (DNMT3A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNMT3A (1788)
Length:
4244
CDS:
203..2941

Additional Resources:

NCBI RefSeq record:
XM_005264175.5
NBCI Gene record:
DNMT3A (1788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430317 GGTAGCGACACAAAGTTAAAC pLKO_005 2962 3UTR 100% 13.200 18.480 N DNMT3A n/a
2 TRCN0000359100 CGCTCCGCTGAAGGAGTATTT pLKO_005 2908 CDS 100% 13.200 10.560 N DNMT3A n/a
3 TRCN0000035754 CCCAAGGTCAAGGAGATTATT pLKO.1 1595 CDS 100% 15.000 10.500 N DNMT3A n/a
4 TRCN0000418113 GGCATCCACTGTGAATGATAA pLKO_005 2617 CDS 100% 13.200 9.240 N DNMT3A n/a
5 TRCN0000359101 TCCAGATGTTCTTCGCTAATA pLKO_005 2016 CDS 100% 13.200 9.240 N DNMT3A n/a
6 TRCN0000231274 AGAGGGACATCTCGCGATTTC pLKO_005 2499 CDS 100% 10.800 7.560 N Dnmt3a n/a
7 TRCN0000433210 AGCGTCACACAGAAGCATATC pLKO_005 2267 CDS 100% 10.800 7.560 N DNMT3A n/a
8 TRCN0000035758 CCACCAGAAGAAGAGAAGAAT pLKO.1 1472 CDS 100% 5.625 3.938 N DNMT3A n/a
9 TRCN0000035755 CCGGCTCTTCTTTGAGTTCTA pLKO.1 2386 CDS 100% 4.950 3.465 N DNMT3A n/a
10 TRCN0000035756 GCCTCAGAGCTATTACCCAAT pLKO.1 452 CDS 100% 4.050 2.835 N DNMT3A n/a
11 TRCN0000035757 CCAGATGTTCTTCGCTAATAA pLKO.1 2017 CDS 100% 15.000 9.000 N DNMT3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00454 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00454 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473305 TCCTGATCAGAATGGATACCCTAC pLX_317 14.2% 100% 100% V5 n/a
Download CSV