Transcript: Human XM_005264231.4

PREDICTED: Homo sapiens FOS like 2, AP-1 transcription factor subunit (FOSL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOSL2 (2355)
Length:
1585
CDS:
867..1484

Additional Resources:

NCBI RefSeq record:
XM_005264231.4
NBCI Gene record:
FOSL2 (2355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329711 GCAGAAATTCCGGGTAGATAT pLKO_005 965 CDS 100% 13.200 18.480 N FOSL2 n/a
2 TRCN0000016139 CAGCAGAAATTCCGGGTAGAT pLKO.1 963 CDS 100% 4.950 3.465 N FOSL2 n/a
3 TRCN0000016141 CACCTCCATGTCCAACCCATA pLKO.1 1073 CDS 100% 4.050 2.835 N FOSL2 n/a
4 TRCN0000016142 CACGGCCCAGTGTGCAAGATT pLKO.1 1528 3UTR 100% 1.875 1.313 N FOSL2 n/a
5 TRCN0000329767 CACGGCCCAGTGTGCAAGATT pLKO_005 1528 3UTR 100% 1.875 1.313 N FOSL2 n/a
6 TRCN0000263186 GTGATCACCTCCATGTCCAAT pLKO_005 1068 CDS 100% 4.950 3.960 N Fosl2 n/a
7 TRCN0000225639 TGATCACCTCCATGTCCAATC pLKO_005 1069 CDS 100% 6.000 4.200 N LOC634417 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00587 pDONR223 100% 47.3% 51% None 463_565del;615_616ins466 n/a
2 ccsbBroad304_00587 pLX_304 0% 47.3% 51% V5 463_565del;615_616ins466 n/a
3 TRCN0000472210 TTCATCCTCTCAACCTCCAGTACC pLX_317 47.7% 47.3% 51% V5 463_565del;615_616ins466 n/a
Download CSV