Transcript: Human XM_005264447.3

PREDICTED: Homo sapiens protein phosphatase 4 regulatory subunit 3B (PPP4R3B), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP4R3B (57223)
Length:
4961
CDS:
417..2342

Additional Resources:

NCBI RefSeq record:
XM_005264447.3
NBCI Gene record:
PPP4R3B (57223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219969 TCGCTTTATGAGGCGGATAAT pLKO.1 1565 CDS 100% 13.200 18.480 N PPP4R3B n/a
2 TRCN0000374655 TGAACAGTGTACCATCTATAT pLKO_005 1861 CDS 100% 13.200 18.480 N Ppp4r3b n/a
3 TRCN0000149086 GTAATGTGTTACGGGTCCATT pLKO.1 3605 3UTR 100% 4.950 6.930 N PPP4R3B n/a
4 TRCN0000215466 GATCAGCTGCTACAGATATAT pLKO.1 931 CDS 100% 15.000 10.500 N Ppp4r3b n/a
5 TRCN0000215574 GATGAAGAAATGTGGTTTAAT pLKO.1 1926 CDS 100% 15.000 10.500 N Ppp4r3b n/a
6 TRCN0000426918 TTGATTGCTTGCTAGTAATTA pLKO_005 2520 3UTR 100% 15.000 10.500 N PPP4R3B n/a
7 TRCN0000418244 AGTCTCTTACTGCCCATATAG pLKO_005 1738 CDS 100% 13.200 9.240 N PPP4R3B n/a
8 TRCN0000183749 CCTGGAATCGTTTAATCTAAA pLKO.1 3629 3UTR 100% 13.200 9.240 N PPP4R3B n/a
9 TRCN0000425033 CTAAGAGAGTTTAGTTCTAAT pLKO_005 2477 3UTR 100% 13.200 9.240 N PPP4R3B n/a
10 TRCN0000366121 GGGACTTCTTCGTACTCTAAT pLKO_005 1106 CDS 100% 13.200 9.240 N Ppp4r3b n/a
11 TRCN0000425019 TTGGTTGGCTTAGTGGATTAT pLKO_005 2253 CDS 100% 13.200 9.240 N PPP4R3B n/a
12 TRCN0000183522 GACCAATACTTCAGAAGACAA pLKO.1 1229 CDS 100% 4.950 3.465 N PPP4R3B n/a
13 TRCN0000148384 CCAACCAAGAATAGTGCTGAA pLKO.1 3228 3UTR 100% 4.050 2.835 N PPP4R3B n/a
14 TRCN0000149294 GCTGTTCAGTTAATGGGACTT pLKO.1 1092 CDS 100% 4.050 2.835 N PPP4R3B n/a
15 TRCN0000219970 GATAATGGAACTCGGTATAAT pLKO.1 1662 CDS 100% 15.000 9.000 N PPP4R3B n/a
16 TRCN0000183123 CGATTGAATATGTTCAGACAT pLKO.1 1786 CDS 100% 4.950 2.475 Y PPP4R3B n/a
17 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4409 3UTR 100% 4.950 2.475 Y C16orf89 n/a
18 TRCN0000145323 GAAGATGAAGAAGAGGAAGAT pLKO.1 1947 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.