Transcript: Human XM_005264546.2

PREDICTED: Homo sapiens exportin 1 (XPO1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XPO1 (7514)
Length:
3953
CDS:
245..3067

Additional Resources:

NCBI RefSeq record:
XM_005264546.2
NBCI Gene record:
XPO1 (7514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338401 ATTCGACTTGCGTACTCAAAT pLKO_005 761 CDS 100% 13.200 18.480 N XPO1 n/a
2 TRCN0000150975 CCATTGTAAAGCGACTTCAAA pLKO.1 3623 3UTR 100% 5.625 7.875 N XPO1 n/a
3 TRCN0000338464 CCATTGTAAAGCGACTTCAAA pLKO_005 3623 3UTR 100% 5.625 7.875 N XPO1 n/a
4 TRCN0000151911 CCTGCTTTCAAGGAACATTTA pLKO.1 2876 CDS 100% 13.200 9.240 N XPO1 n/a
5 TRCN0000152186 CAGCTATATTTGCCCATGTTA pLKO.1 1070 CDS 100% 5.625 3.938 N XPO1 n/a
6 TRCN0000153707 CCTCAACAGGTTCATACGTTT pLKO.1 1730 CDS 100% 4.950 3.465 N XPO1 n/a
7 TRCN0000152210 CCTTCATTAACTCGAAGTGAA pLKO.1 3763 3UTR 100% 4.950 3.465 N XPO1 n/a
8 TRCN0000155267 GCAGGTGAAGACACTTCTGAT pLKO.1 2927 CDS 100% 4.950 3.465 N XPO1 n/a
9 TRCN0000154386 CCTCACCTACAAGATGCTCAA pLKO.1 2810 CDS 100% 4.050 2.835 N XPO1 n/a
10 TRCN0000338399 CCTCACCTACAAGATGCTCAA pLKO_005 2810 CDS 100% 4.050 2.835 N XPO1 n/a
11 TRCN0000152787 GCTCATTTGTGAGCCTTCATT pLKO.1 3750 3UTR 100% 0.563 0.394 N XPO1 n/a
12 TRCN0000151579 GCATGCATCAATTCTTGCATA pLKO.1 2674 CDS 100% 0.495 0.347 N XPO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01784 pDONR223 100% 87.7% 87.7% None 0_1ins393 n/a
2 ccsbBroad304_01784 pLX_304 0% 87.7% 87.7% V5 0_1ins393 n/a
3 TRCN0000472757 TGCAGTGAAAATAAGCGTGGGTGC pLX_317 14.1% 87.7% 87.7% V5 0_1ins393 n/a
Download CSV