Transcript: Human XM_005264784.1

PREDICTED: Homo sapiens RNA binding motif protein 6 (RBM6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM6 (10180)
Length:
4011
CDS:
920..3895

Additional Resources:

NCBI RefSeq record:
XM_005264784.1
NBCI Gene record:
RBM6 (10180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422718 GACTGGTCTTCAGATACAAAT pLKO_005 2840 CDS 100% 13.200 18.480 N RBM6 n/a
2 TRCN0000151373 GAAGGAGTATAACACAGGTTA pLKO.1 1990 CDS 100% 4.950 6.930 N RBM6 n/a
3 TRCN0000432533 ACGGAACACAAGTAGACTTTA pLKO_005 1209 CDS 100% 13.200 10.560 N RBM6 n/a
4 TRCN0000421006 AGAACCTTGATCCGCCATTTA pLKO_005 2682 CDS 100% 13.200 10.560 N RBM6 n/a
5 TRCN0000154124 CCAGCAGGCTTATTCGATTAA pLKO.1 1884 CDS 100% 13.200 10.560 N RBM6 n/a
6 TRCN0000445555 GATCGGCCTCTTGGGTGAATA pLKO_005 3226 CDS 100% 13.200 10.560 N RBM6 n/a
7 TRCN0000155013 GCACCGATCTTCCTGTTCATT pLKO.1 2176 CDS 100% 5.625 4.500 N RBM6 n/a
8 TRCN0000427817 GTCATGTTTGCTCGATATAAA pLKO_005 3863 CDS 100% 15.000 10.500 N RBM6 n/a
9 TRCN0000431588 GAATAGAGATGTATCTGATTT pLKO_005 1171 CDS 100% 13.200 9.240 N RBM6 n/a
10 TRCN0000434171 GACCTTCAGGATCAAGATTAT pLKO_005 1838 CDS 100% 13.200 9.240 N RBM6 n/a
11 TRCN0000054746 GAGTCATGTTTGCTCGATATA pLKO.1 3861 CDS 100% 13.200 9.240 N Rbm6 n/a
12 TRCN0000288365 GAGTCATGTTTGCTCGATATA pLKO_005 3861 CDS 100% 13.200 9.240 N Rbm6 n/a
13 TRCN0000152100 CAAATGTAGAGGAGCATTCTT pLKO.1 720 5UTR 100% 5.625 3.938 N RBM6 n/a
14 TRCN0000155549 CCACCAGTCAAGGAAAGTCAA pLKO.1 3027 CDS 100% 4.950 3.465 N RBM6 n/a
15 TRCN0000154498 GCCTATCTGGAAAGGAGAGAA pLKO.1 3515 CDS 100% 4.950 3.465 N RBM6 n/a
16 TRCN0000152718 CAAAGAAGTTACCCTGGAGTA pLKO.1 2101 CDS 100% 4.050 2.835 N RBM6 n/a
17 TRCN0000154391 CCAGCTGATAAGGAACCTGAA pLKO.1 2312 CDS 100% 4.050 2.835 N RBM6 n/a
18 TRCN0000155391 CGGATTAAGTACTCCAGGGAA pLKO.1 3611 CDS 100% 2.640 1.848 N RBM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07565 pDONR223 100% 60.6% 60.6% None 1_1170del;2925C>T n/a
2 ccsbBroad304_07565 pLX_304 0% 60.6% 60.6% V5 1_1170del;2925C>T n/a
3 TRCN0000470808 ATATTGCACCGCAATAGTACTGAT pLX_317 27.9% 60.6% 60.6% V5 1_1170del;2925C>T n/a
Download CSV