Transcript: Human XM_005266251.4

PREDICTED: Homo sapiens Kruppel like factor 12 (KLF12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF12 (11278)
Length:
10081
CDS:
324..1532

Additional Resources:

NCBI RefSeq record:
XM_005266251.4
NBCI Gene record:
KLF12 (11278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230480 GCCAGTGGACTTGTCAATAAA pLKO_005 563 CDS 100% 15.000 21.000 N KLF12 n/a
2 TRCN0000217977 CTATCTCCCAGACAAAGTAAA pLKO_005 1014 CDS 100% 13.200 18.480 N KLF12 n/a
3 TRCN0000015805 CGTCCACAACTATCCCGATAT pLKO.1 455 CDS 100% 10.800 15.120 N KLF12 n/a
4 TRCN0000015806 CGAGGCATTACCGCAAACATA pLKO.1 1417 CDS 100% 5.625 7.875 N KLF12 n/a
5 TRCN0000015804 GCGTTAATGAAACTGGATCTA pLKO.1 1078 CDS 100% 4.950 6.930 N KLF12 n/a
6 TRCN0000015803 GCACATATTAACCTCACAATA pLKO.1 3317 3UTR 100% 13.200 10.560 N KLF12 n/a
7 TRCN0000230483 TATTAGGAAACCGGCTTATAA pLKO_005 5942 3UTR 100% 15.000 10.500 N KLF12 n/a
8 TRCN0000230482 GCGTATCCACAGATGTGATTT pLKO_005 1265 CDS 100% 13.200 9.240 N KLF12 n/a
9 TRCN0000226306 GTGACCTTAGATAGCGTTAAT pLKO_005 1065 CDS 100% 13.200 9.240 N Klf12 n/a
10 TRCN0000230481 GTGACCTTAGATAGCGTTAAT pLKO_005 1065 CDS 100% 13.200 9.240 N KLF12 n/a
11 TRCN0000015807 CCTTGTTCAATTTCACCATTT pLKO.1 1188 CDS 100% 10.800 6.480 N KLF12 n/a
12 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1348 CDS 100% 13.200 6.600 Y Znf41-ps n/a
13 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1348 CDS 100% 13.200 6.600 Y EG666605 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07793 pDONR223 100% 99.9% 100% None 840C>A n/a
2 ccsbBroad304_07793 pLX_304 0% 99.9% 100% V5 840C>A n/a
3 TRCN0000470107 GAAATTCAATCTAGGGCCCATTTG pLX_317 36.6% 99.9% 100% V5 840C>A n/a
Download CSV