Transcript: Human XM_005266346.4

PREDICTED: Homo sapiens neurobeachin (NBEA), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBEA (26960)
Length:
11105
CDS:
535..9360

Additional Resources:

NCBI RefSeq record:
XM_005266346.4
NBCI Gene record:
NBEA (26960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266346.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420452 GTTTCGTATGGATCCATTAAA pLKO_005 1320 CDS 100% 15.000 21.000 N NBEA n/a
2 TRCN0000033604 GCCGACTCTTTGCAGTGAATA pLKO.1 8381 CDS 100% 13.200 10.560 N NBEA n/a
3 TRCN0000418854 TATTGCAGGACGGACATATAA pLKO_005 7449 CDS 100% 15.000 10.500 N NBEA n/a
4 TRCN0000423471 CCCAATAGTAGTACATCATTT pLKO_005 3952 CDS 100% 13.200 9.240 N NBEA n/a
5 TRCN0000033605 CGGACTACAATGTTTCGTATT pLKO.1 4507 CDS 100% 10.800 7.560 N NBEA n/a
6 TRCN0000033607 GCACGGAAGAAGATGTAGTAA pLKO.1 6839 CDS 100% 5.625 3.938 N NBEA n/a
7 TRCN0000033608 CCGGATGAAATTCGCAGTGTT pLKO.1 744 CDS 100% 4.950 3.465 N NBEA n/a
8 TRCN0000033606 CGGTGTTATGTTAATGGACAA pLKO.1 1561 CDS 100% 4.050 2.430 N NBEA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266346.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.