Transcript: Human XM_005266374.2

PREDICTED: Homo sapiens lymphocyte cytosolic protein 1 (LCP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LCP1 (3936)
Length:
3675
CDS:
124..2007

Additional Resources:

NCBI RefSeq record:
XM_005266374.2
NBCI Gene record:
LCP1 (3936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422371 TAGAAGCTGCAGTGGTATTAA pLKO_005 2313 3UTR 100% 15.000 21.000 N LCP1 n/a
2 TRCN0000429857 ACTGAATATCCTCGAAGAAAT pLKO_005 1632 CDS 100% 13.200 18.480 N LCP1 n/a
3 TRCN0000056494 CCTGGGTATAGAGTACGAGAA pLKO.1 259 CDS 100% 4.050 5.670 N LCP1 n/a
4 TRCN0000056496 GTCATCAAGATTGGGTTGTTT pLKO.1 814 CDS 100% 5.625 4.500 N LCP1 n/a
5 TRCN0000056493 GCGGACATTTAGGAACTGGAT pLKO.1 1314 CDS 100% 2.640 2.112 N LCP1 n/a
6 TRCN0000412275 GTTTCAAGGACCCGAAGATTA pLKO_005 1742 CDS 100% 13.200 9.240 N LCP1 n/a
7 TRCN0000056495 CCAACCAGGTTCCATTAACTA pLKO.1 1800 CDS 100% 5.625 3.938 N LCP1 n/a
8 TRCN0000056497 CAGAGTAAACAAACCGCCATA pLKO.1 1443 CDS 100% 4.050 2.835 N LCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06517 pDONR223 100% 99.9% 99.8% None 1597A>G n/a
2 ccsbBroad304_06517 pLX_304 0% 99.9% 99.8% V5 1597A>G n/a
3 TRCN0000474511 AGTCCACCCGGTGTGAGGAGTATT pLX_317 30.2% 99.9% 99.8% V5 1597A>G n/a
Download CSV