Transcript: Human XM_005266403.3

PREDICTED: Homo sapiens SMAD family member 9 (SMAD9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMAD9 (4093)
Length:
4544
CDS:
305..1486

Additional Resources:

NCBI RefSeq record:
XM_005266403.3
NBCI Gene record:
SMAD9 (4093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019446 CACGGCTTTGAAGTCGTGTAT pLKO.1 1244 CDS 100% 4.950 6.930 N SMAD9 n/a
2 TRCN0000019445 CGACCCTTCAAATAACAGGAA pLKO.1 952 CDS 100% 2.640 3.696 N SMAD9 n/a
3 TRCN0000019447 GCAGAAAGAAGTGTGCATTAA pLKO.1 664 CDS 100% 13.200 9.240 N SMAD9 n/a
4 TRCN0000019448 CGTGTATGAACTGACCAAGAT pLKO.1 1258 CDS 100% 4.950 3.465 N SMAD9 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3166 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3331 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00965 pDONR223 100% 76.5% 65.5% None (many diffs) n/a
2 ccsbBroad304_00965 pLX_304 0% 76.5% 65.5% V5 (many diffs) n/a
3 TRCN0000480230 TCTCGAACATTAGCTTCACAAGTC pLX_317 30.1% 76.5% 65.5% V5 (many diffs) n/a
Download CSV