Transcript: Human XM_005266642.3

PREDICTED: Homo sapiens CD226 molecule (CD226), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD226 (10666)
Length:
5645
CDS:
549..1559

Additional Resources:

NCBI RefSeq record:
XM_005266642.3
NBCI Gene record:
CD226 (10666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416820 GTACTCATGCATGGATCTTTA pLKO_005 1599 3UTR 100% 13.200 18.480 N CD226 n/a
2 TRCN0000057636 CGCAGACCAAAGACTAGAGTT pLKO.1 1536 CDS 100% 4.950 3.960 N CD226 n/a
3 TRCN0000434449 ATGATACAAGAGAGGATATTT pLKO_005 1492 CDS 100% 15.000 10.500 N CD226 n/a
4 TRCN0000421790 GCTTTGGGCAAGGGCTATTTA pLKO_005 1812 3UTR 100% 15.000 10.500 N CD226 n/a
5 TRCN0000421963 ATCCATCAATGGGCATCTTAA pLKO_005 664 CDS 100% 13.200 9.240 N CD226 n/a
6 TRCN0000057637 GCCGAGAACATGTCTCTAGAA pLKO.1 636 CDS 100% 4.950 3.465 N CD226 n/a
7 TRCN0000057633 GCTTCCAATAACATGACTCTT pLKO.1 807 CDS 100% 4.950 3.465 N CD226 n/a
8 TRCN0000057635 CCCAAGACAAATAGTGAGCAA pLKO.1 1121 CDS 100% 2.640 1.848 N CD226 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07666 pDONR223 100% 99.9% 99.7% None 919A>G n/a
2 ccsbBroad304_07666 pLX_304 0% 99.9% 99.7% V5 919A>G n/a
3 TRCN0000480825 TGTTGGCTCTCGCACATGCACCCA pLX_317 33.2% 99.9% 99.7% V5 919A>G n/a
Download CSV