Transcript: Human XM_005266652.3

PREDICTED: Homo sapiens ring finger protein 152 (RNF152), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF152 (220441)
Length:
8803
CDS:
407..1018

Additional Resources:

NCBI RefSeq record:
XM_005266652.3
NBCI Gene record:
RNF152 (220441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417708 CTAAATGCGGTAGATTCAAAC pLKO_005 1372 3UTR 100% 10.800 15.120 N RNF152 n/a
2 TRCN0000007765 TCATCGCCATTCCACACACTT pLKO.1 639 CDS 100% 4.950 6.930 N RNF152 n/a
3 TRCN0000007763 CCCTGTAGTATAGTACGTGAT pLKO.1 3212 3UTR 100% 4.050 5.670 N RNF152 n/a
4 TRCN0000007767 CGGTCTTCATCAAACTTCCCA pLKO.1 672 CDS 100% 0.750 0.600 N RNF152 n/a
5 TRCN0000436417 ATGTCAGATCTGTTTCAATTA pLKO_005 439 CDS 100% 13.200 9.240 N RNF152 n/a
6 TRCN0000436456 TATTCTACTTAGACGTTAAAC pLKO_005 1323 3UTR 100% 13.200 9.240 N RNF152 n/a
7 TRCN0000007764 CTTCACAACATGTCTTGCATT pLKO.1 965 CDS 100% 4.950 3.465 N RNF152 n/a
8 TRCN0000007766 GCCCAAGTTGCTGGACTGCAA pLKO.1 478 CDS 100% 0.880 0.616 N RNF152 n/a
9 TRCN0000432275 TGATTGCATGCATCCTCATAA pLKO_005 1244 3UTR 100% 13.200 7.920 N RNF152 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6464 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6577 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6464 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09860 pDONR223 100% 99.8% 100% None 180G>T n/a
2 ccsbBroad304_09860 pLX_304 0% 99.8% 100% V5 180G>T n/a
3 TRCN0000476363 TTCCGTTAGGACTGTCTCCACGAC pLX_317 18.9% 99.8% 100% V5 180G>T n/a
Download CSV