Transcript: Human XM_005266961.4

PREDICTED: Homo sapiens nucleoporin 43 (NUP43), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP43 (348995)
Length:
3922
CDS:
26..1027

Additional Resources:

NCBI RefSeq record:
XM_005266961.4
NBCI Gene record:
NUP43 (348995)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266961.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137417 GCAGATAGTAGTACACTCCAT pLKO.1 533 CDS 100% 2.640 3.696 N NUP43 n/a
2 TRCN0000292216 GCAGATAGTAGTACACTCCAT pLKO_005 533 CDS 100% 2.640 3.696 N NUP43 n/a
3 TRCN0000137311 GAACCGATGCAGAAGCAATTT pLKO.1 1222 3UTR 100% 13.200 9.240 N NUP43 n/a
4 TRCN0000292217 GAACCGATGCAGAAGCAATTT pLKO_005 1222 3UTR 100% 13.200 9.240 N NUP43 n/a
5 TRCN0000137036 CACTGTGGTCTATTGGAGATT pLKO.1 159 CDS 100% 4.950 3.465 N NUP43 n/a
6 TRCN0000134269 GACCATCAGTTATTGTGTGAT pLKO.1 215 CDS 100% 4.950 3.465 N NUP43 n/a
7 TRCN0000297965 GACCATCAGTTATTGTGTGAT pLKO_005 215 CDS 100% 4.950 3.465 N NUP43 n/a
8 TRCN0000136701 GCCAAGATGGAATGTTGAGTA pLKO.1 735 CDS 100% 4.950 3.465 N NUP43 n/a
9 TRCN0000137797 GCTACAGGATCTTGGGACAAT pLKO.1 122 CDS 100% 4.950 3.465 N NUP43 n/a
10 TRCN0000134068 GCTGTAAGAACCATAGACAAT pLKO.1 512 CDS 100% 4.950 3.465 N NUP43 n/a
11 TRCN0000136740 GCATAGCTGAAAGTTGCCAAA pLKO.1 2223 3UTR 100% 4.050 2.835 N NUP43 n/a
12 TRCN0000137855 GCTTCCACAGATGTACCTGAA pLKO.1 896 CDS 100% 4.050 2.835 N NUP43 n/a
13 TRCN0000133881 CCGAATTGAAATCACAAGCTT pLKO.1 1139 3UTR 100% 3.000 2.100 N NUP43 n/a
14 TRCN0000292273 CCGAATTGAAATCACAAGCTT pLKO_005 1139 3UTR 100% 3.000 2.100 N NUP43 n/a
15 TRCN0000134871 CCAAGATGGAATGTTGAGTAT pLKO.1 736 CDS 100% 4.950 2.970 N NUP43 n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3019 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3019 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266961.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05518 pDONR223 100% 83.3% 76.3% None (many diffs) n/a
2 ccsbBroad304_05518 pLX_304 0% 83.3% 76.3% V5 (many diffs) n/a
3 TRCN0000467607 CCTAACTCCGCTCCAAGGCTAGCG pLX_317 39.2% 83.3% 76.3% V5 (many diffs) n/a
Download CSV