Transcript: Human XM_005267049.2

PREDICTED: Homo sapiens ethylmalonyl-CoA decarboxylase 1 (ECHDC1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECHDC1 (55862)
Length:
2553
CDS:
526..981

Additional Resources:

NCBI RefSeq record:
XM_005267049.2
NBCI Gene record:
ECHDC1 (55862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052478 GCCTGCAAATTTAGAGGCTAT pLKO.1 1348 3UTR 100% 4.050 5.670 N ECHDC1 n/a
2 TRCN0000052482 GCATTACAGAACGAAAGAGAT pLKO.1 1304 3UTR 100% 4.950 3.960 N ECHDC1 n/a
3 TRCN0000435228 TCCAGAGACTTCCTTTAATAA pLKO_005 900 CDS 100% 15.000 10.500 N ECHDC1 n/a
4 TRCN0000412678 ATTTACTACAGCATGTGATTT pLKO_005 964 CDS 100% 13.200 9.240 N ECHDC1 n/a
5 TRCN0000052479 CCACAAAGAGATGGGCATAAT pLKO.1 1021 3UTR 100% 13.200 9.240 N ECHDC1 n/a
6 TRCN0000191025 CCTGCAAATTTAGAGGCTATT pLKO.1 1349 3UTR 100% 10.800 7.560 N Echdc1 n/a
7 TRCN0000412766 TATAGTACATCCCATGGATTT pLKO_005 619 CDS 100% 10.800 7.560 N ECHDC1 n/a
8 TRCN0000433408 AGTTTCCTGGTGGATCCATTG pLKO_005 671 CDS 100% 6.000 4.200 N ECHDC1 n/a
9 TRCN0000421140 ACTCTGAACAATCCAAGTAGA pLKO_005 727 CDS 100% 4.950 3.465 N ECHDC1 n/a
10 TRCN0000428313 CATTGGCATTCTTACTCTGAA pLKO_005 714 CDS 100% 4.950 3.465 N ECHDC1 n/a
11 TRCN0000414391 GCTACATCAAACAGGATTGTC pLKO_005 594 CDS 100% 4.950 3.465 N ECHDC1 n/a
12 TRCN0000052481 CCAAGTAGAATGAATGCCTTT pLKO.1 739 CDS 100% 4.050 2.835 N ECHDC1 n/a
13 TRCN0000436509 TAATAAGTGTTGCGCTGGTTC pLKO_005 915 CDS 100% 4.050 2.430 N ECHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03671 pDONR223 100% 47.2% 37.9% None 1_18del;378_379ins53;453_454ins415 n/a
2 ccsbBroad304_03671 pLX_304 0% 47.2% 37.9% V5 1_18del;378_379ins53;453_454ins415 n/a
3 TRCN0000467959 GAAAAGTACATTAACGTACGGTCC pLX_317 49.4% 47.2% 37.9% V5 1_18del;378_379ins53;453_454ins415 n/a
Download CSV