Transcript: Human XM_005267267.3

PREDICTED: Homo sapiens fibulin 5 (FBLN5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBLN5 (10516)
Length:
2468
CDS:
258..1655

Additional Resources:

NCBI RefSeq record:
XM_005267267.3
NBCI Gene record:
FBLN5 (10516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267267.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310288 CGATCTCCAGGCCTCTTATAT pLKO_005 625 CDS 100% 15.000 21.000 N FBLN5 n/a
2 TRCN0000053560 GCGGATATATGTGTCGCAGTA pLKO.1 1625 CDS 100% 4.050 5.670 N FBLN5 n/a
3 TRCN0000053561 GCAGCAGACGTGCTACAATTT pLKO.1 1211 CDS 100% 13.200 9.240 N FBLN5 n/a
4 TRCN0000290061 GCAGCAGACGTGCTACAATTT pLKO_005 1211 CDS 100% 13.200 9.240 N FBLN5 n/a
5 TRCN0000296506 TGACTCTCACCTGTACTATTG pLKO_005 1798 3UTR 100% 10.800 7.560 N FBLN5 n/a
6 TRCN0000053559 CGAGGAGACATGATGTGTGTT pLKO.1 468 CDS 100% 4.950 3.465 N FBLN5 n/a
7 TRCN0000290063 CGAGGAGACATGATGTGTGTT pLKO_005 468 CDS 100% 4.950 3.465 N FBLN5 n/a
8 TRCN0000053558 GCTGACATCTTCCAAATGCAA pLKO.1 1395 CDS 100% 3.000 2.100 N FBLN5 n/a
9 TRCN0000290062 GCTGACATCTTCCAAATGCAA pLKO_005 1395 CDS 100% 3.000 2.100 N FBLN5 n/a
10 TRCN0000053562 CCAGGATATGAACTTGAGGAA pLKO.1 1008 CDS 100% 2.640 1.848 N FBLN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267267.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07626 pDONR223 100% 95.9% 94.2% None (many diffs) n/a
2 ccsbBroad304_07626 pLX_304 0% 95.9% 94.2% V5 (many diffs) n/a
3 TRCN0000476678 CTCTAATCCCCGTCTACTAGGATA pLX_317 25.6% 95.9% 94.2% V5 (many diffs) n/a
Download CSV