Transcript: Human XM_005267355.4

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 36 (PPP1R36), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R36 (145376)
Length:
1354
CDS:
170..1306

Additional Resources:

NCBI RefSeq record:
XM_005267355.4
NBCI Gene record:
PPP1R36 (145376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267355.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420336 GACTCTTTCGTACCAATATGT pLKO_005 831 CDS 100% 5.625 7.875 N PPP1R36 n/a
2 TRCN0000427432 TCATACATCATGCCCTAAGTA pLKO_005 1285 CDS 100% 5.625 7.875 N PPP1R36 n/a
3 TRCN0000168243 CGTCAACACTTGACAGAGATT pLKO.1 794 CDS 100% 4.950 6.930 N PPP1R36 n/a
4 TRCN0000430406 ACAACATTTATGAGGAATAAG pLKO_005 458 CDS 100% 13.200 9.240 N PPP1R36 n/a
5 TRCN0000418200 CATTACACTGGATGATGTTAA pLKO_005 382 CDS 100% 13.200 9.240 N PPP1R36 n/a
6 TRCN0000414267 CATCAAGTAGACGTCAGATTC pLKO_005 1046 CDS 100% 10.800 7.560 N PPP1R36 n/a
7 TRCN0000167591 GTACTACTTATCCCATTACTT pLKO.1 508 CDS 100% 5.625 3.938 N PPP1R36 n/a
8 TRCN0000167090 CATGGCATTATTGTACTACTT pLKO.1 496 CDS 100% 4.950 3.465 N PPP1R36 n/a
9 TRCN0000433713 TGTAGAGAAACGAGGTCAACA pLKO_005 355 CDS 100% 4.950 3.465 N PPP1R36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267355.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09617 pDONR223 100% 89.4% 89% None 0_1ins132;2T>G;116C>T n/a
2 ccsbBroad304_09617 pLX_304 0% 89.4% 89% V5 0_1ins132;2T>G;116C>T n/a
3 TRCN0000481503 CGTGCTCCCGCGCTCGGATTTTTC pLX_317 35.3% 89.4% 89% V5 0_1ins132;2T>G;116C>T n/a
Download CSV