Transcript: Human XM_005267510.1

PREDICTED: Homo sapiens LDL receptor related protein 10 (LRP10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP10 (26020)
Length:
6910
CDS:
692..2857

Additional Resources:

NCBI RefSeq record:
XM_005267510.1
NBCI Gene record:
LRP10 (26020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431302 ACAGATCTTACGCCAGGATAT pLKO_005 2302 CDS 100% 10.800 15.120 N LRP10 n/a
2 TRCN0000063423 GCTCTACTCATAGTGGCACAA pLKO.1 2896 3UTR 100% 4.050 5.670 N LRP10 n/a
3 TRCN0000063424 CCCATCCAGACCGGATTATTT pLKO.1 738 CDS 100% 15.000 10.500 N LRP10 n/a
4 TRCN0000415276 GAGATGCAGTGCATGTGTATG pLKO_005 1446 CDS 100% 10.800 7.560 N LRP10 n/a
5 TRCN0000063425 CCGCTGCAACTACCAGACTTT pLKO.1 1852 CDS 100% 4.950 3.465 N LRP10 n/a
6 TRCN0000063426 GAAGACTTTCCTACAGAGAAT pLKO.1 2240 CDS 100% 4.950 3.465 N LRP10 n/a
7 TRCN0000063427 GCCATCACTATTGTCTGGAGT pLKO.1 2656 CDS 100% 2.640 1.848 N LRP10 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5776 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5776 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 5442 3UTR 100% 4.950 2.475 Y DENND6A n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5608 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 5852 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5774 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5774 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5774 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.