Transcript: Human XM_005267550.4

PREDICTED: Homo sapiens centrosomal protein 170B (CEP170B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP170B (283638)
Length:
6780
CDS:
212..4981

Additional Resources:

NCBI RefSeq record:
XM_005267550.4
NBCI Gene record:
CEP170B (283638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432540 GCTACGATTCCAACATGTATG pLKO_005 480 CDS 100% 10.800 15.120 N CEP170B n/a
2 TRCN0000168281 GTGTTATCTAGGAAACCGCTT pLKO.1 2630 CDS 100% 2.160 1.728 N CEP170B n/a
3 TRCN0000416550 GTCAGTGCCAATGGGAGAATG pLKO_005 2723 CDS 100% 10.800 7.560 N CEP170B n/a
4 TRCN0000172296 CCCTGGCAAGATGAAGATCAA pLKO.1 1042 CDS 100% 4.950 3.465 N CEP170B n/a
5 TRCN0000172777 GCCTCCTCTTCATCACTGTTA pLKO.1 5274 3UTR 100% 4.950 3.465 N CEP170B n/a
6 TRCN0000167962 CGAGAAGATGAAGATCCTCTT pLKO.1 4576 CDS 100% 4.050 2.835 N CEP170B n/a
7 TRCN0000168618 GAAAGAGTTGTTGGTGCCATT pLKO.1 5316 3UTR 100% 4.050 2.835 N CEP170B n/a
8 TRCN0000168528 CTCCTCTCTAATTCTGTGGAT pLKO.1 2993 CDS 100% 2.640 1.848 N CEP170B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13503 pDONR223 100% 9.6% 9.6% None 1_4305del n/a
2 ccsbBroad304_13503 pLX_304 0% 9.6% 9.6% V5 1_4305del n/a
3 TRCN0000474422 CGTCATTATATTCCTCTCCAGGAT pLX_317 100% 9.6% 9.6% V5 1_4305del n/a
Download CSV