Transcript: Human XM_005267890.5

PREDICTED: Homo sapiens pellino E3 ubiquitin protein ligase family member 2 (PELI2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PELI2 (57161)
Length:
4903
CDS:
333..1076

Additional Resources:

NCBI RefSeq record:
XM_005267890.5
NBCI Gene record:
PELI2 (57161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151627 GCAAAGGTCAACACAGTATAT pLKO.1 550 CDS 100% 13.200 18.480 N PELI2 n/a
2 TRCN0000156081 CTCGGGTACAATGGTGCTTTA pLKO.1 405 CDS 100% 10.800 15.120 N PELI2 n/a
3 TRCN0000154729 GCCGGATTTGACTCTTCCAAA pLKO.1 804 CDS 100% 4.950 6.930 N PELI2 n/a
4 TRCN0000153521 CAGATCAACAGAAAGCCCTAT pLKO.1 647 CDS 100% 4.050 2.835 N PELI2 n/a
5 TRCN0000154430 GAACCTTACACAGCACGGATA pLKO.1 777 CDS 100% 4.050 2.835 N PELI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08713 pDONR223 100% 57.4% 56.1% None (many diffs) n/a
2 ccsbBroad304_08713 pLX_304 0% 57.4% 56.1% V5 (many diffs) n/a
3 TRCN0000477173 GCAAGACGTCATATGTCCCCACTC pLX_317 26.5% 57.4% 56.1% V5 (many diffs) n/a
4 ccsbBroadEn_03799 pDONR223 100% 57.4% 56.1% None (many diffs) n/a
5 ccsbBroad304_03799 pLX_304 0% 57.4% 56.1% V5 (many diffs) n/a
Download CSV