Transcript: Human XM_005268237.3

PREDICTED: Homo sapiens protein only RNase P catalytic subunit (PRORP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRORP (9692)
Length:
2772
CDS:
509..2260

Additional Resources:

NCBI RefSeq record:
XM_005268237.3
NBCI Gene record:
PRORP (9692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432154 ACGATTTACTGGTCAAGTATT pLKO_005 1032 CDS 100% 13.200 18.480 N PRORP n/a
2 TRCN0000415321 CTCTATAGATGTGGCTAAATC pLKO_005 967 CDS 100% 13.200 18.480 N PRORP n/a
3 TRCN0000432974 GTTTCGAAAGTTGGATCATTT pLKO_005 924 CDS 100% 13.200 18.480 N PRORP n/a
4 TRCN0000134862 CCTACCAATAGCAGAATCAAT pLKO.1 2603 3UTR 100% 5.625 7.875 N PRORP n/a
5 TRCN0000134244 CCTGAGATACTCATGTTGTTT pLKO.1 2633 3UTR 100% 5.625 7.875 N PRORP n/a
6 TRCN0000136809 CGGGAATCACTGCAGGTTTAT pLKO.1 1975 CDS 100% 13.200 10.560 N PRORP n/a
7 TRCN0000435788 CACTTAGCTTGGGTGACTAAT pLKO_005 2534 3UTR 100% 13.200 9.240 N PRORP n/a
8 TRCN0000420707 GAATTGCTAGGTCATGATATT pLKO_005 1313 CDS 100% 13.200 9.240 N PRORP n/a
9 TRCN0000136693 GATGACATCTCGGAGGATGAT pLKO.1 1925 CDS 100% 4.950 3.465 N PRORP n/a
10 TRCN0000134890 CAGAATACCAAAGCAACGAAT pLKO.1 668 CDS 100% 4.950 2.970 N PRORP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000474453 TGCGTTCCGCAAATACCAGACGTC pLX_317 31.2% 99.9% 100% V5 87C>G n/a
2 ccsbBroadEn_07467 pDONR223 100% 99.8% 99.8% None 87C>G;1744A>N n/a
3 ccsbBroad304_07467 pLX_304 0% 99.8% 99.8% V5 87C>G;1744A>N n/a
4 ccsbBroadEn_15675 pDONR223 0% 99.9% 99.8% None 1310A>G n/a
5 ccsbBroad304_15675 pLX_304 0% 99.9% 99.8% V5 1310A>G n/a
6 TRCN0000478771 TCGCGTCCAGCTATGGTGGATTAA pLX_317 17.8% 99.9% 99.8% V5 1310A>G n/a
Download CSV