Transcript: Human XM_005268767.5

PREDICTED: Homo sapiens t-complex 11 like 2 (TCP11L2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCP11L2 (255394)
Length:
2833
CDS:
349..1908

Additional Resources:

NCBI RefSeq record:
XM_005268767.5
NBCI Gene record:
TCP11L2 (255394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268767.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157347 CAACGCCAGTTGGTGGAATAT pLKO.1 1060 CDS 100% 13.200 18.480 N TCP11L2 n/a
2 TRCN0000151144 GCTGAGATTCAAGCTAATCTT pLKO.1 1588 CDS 100% 0.563 0.788 N TCP11L2 n/a
3 TRCN0000152321 CGTCTTGGATTCAGAACTAAA pLKO.1 687 CDS 100% 13.200 9.240 N TCP11L2 n/a
4 TRCN0000154593 GAGAACCAAGTTCCAGGAAAT pLKO.1 1083 CDS 100% 10.800 7.560 N TCP11L2 n/a
5 TRCN0000155772 CTTCGCAACCAAATCTGTGAA pLKO.1 799 CDS 100% 4.950 3.465 N TCP11L2 n/a
6 TRCN0000154354 CGAGAGATTGGAAATCCAGTA pLKO.1 1927 3UTR 100% 4.050 2.835 N TCP11L2 n/a
7 TRCN0000157094 GCTCTTCAATGAGGAAGCCAT pLKO.1 1854 CDS 100% 2.640 1.848 N TCP11L2 n/a
8 TRCN0000156156 CCACTTCCATTGATGGCATTA pLKO.1 1962 3UTR 100% 10.800 6.480 N TCP11L2 n/a
9 TRCN0000154691 GCATTAGAGATCCAGCACATT pLKO.1 1977 3UTR 100% 4.950 2.970 N TCP11L2 n/a
10 TRCN0000106351 GCCATCAAACTGTTTGAAGAA pLKO.1 733 CDS 100% 4.950 2.970 N Tcp11l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268767.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05308 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05308 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472762 TCCATTACTCCTTCACTTACGATT pLX_317 32.2% 100% 100% V5 n/a
Download CSV