Transcript: Human XM_005269172.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 44 (USP44), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP44 (84101)
Length:
4109
CDS:
284..2515

Additional Resources:

NCBI RefSeq record:
XM_005269172.1
NBCI Gene record:
USP44 (84101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230246 CTCGCTCAGTCGACCATAATA pLKO_005 938 CDS 100% 15.000 21.000 N USP44 n/a
2 TRCN0000218158 AGTTACTACGACGTACATTAA pLKO_005 570 CDS 100% 13.200 18.480 N USP44 n/a
3 TRCN0000218247 ATGTCAAGGTATCACCTAAAT pLKO_005 2965 3UTR 100% 13.200 18.480 N USP44 n/a
4 TRCN0000230245 GAATTGGAGTATCAAGTTAAA pLKO_005 869 CDS 100% 13.200 18.480 N USP44 n/a
5 TRCN0000038815 CGGCAGGAATTGGAGTATCAA pLKO.1 863 CDS 100% 5.625 4.500 N USP44 n/a
6 TRCN0000230247 TACACTGCCTACTGCTATAAT pLKO_005 2285 CDS 100% 15.000 10.500 N USP44 n/a
7 TRCN0000038818 GCACAGGAGAAGGATACTAAT pLKO.1 736 CDS 100% 13.200 9.240 N USP44 n/a
8 TRCN0000038816 CCTCGTCTAATGAAATCCTTA pLKO.1 2490 CDS 100% 4.950 3.465 N USP44 n/a
9 TRCN0000038817 CCTGTTGCATTGGAGGTGAAT pLKO.1 482 CDS 100% 4.950 3.465 N USP44 n/a
10 TRCN0000038814 CGGATGATGAACTTGTGCAAT pLKO.1 2778 3UTR 100% 4.950 3.465 N USP44 n/a
11 TRCN0000030882 GCTCAGGAATTTCTTTGTGAA pLKO.1 1553 CDS 100% 4.950 3.465 N Usp44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09148 pDONR223 100% 95.6% 95.5% None (many diffs) n/a
2 TRCN0000475720 CCCACTGAACTATGACGCACAATG pLX_317 14.5% 95.6% 95.5% V5 (many diffs) n/a
Download CSV