Transcript: Human XM_005269186.5

PREDICTED: Homo sapiens methyltransferase like 25 (METTL25), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL25 (84190)
Length:
11687
CDS:
67..1434

Additional Resources:

NCBI RefSeq record:
XM_005269186.5
NBCI Gene record:
METTL25 (84190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413705 CTTTGCTCTGGCTGCGAAATA pLKO_005 387 CDS 100% 13.200 9.240 N METTL25 n/a
2 TRCN0000172584 GATGCCCTGTCCATTTCCAAT pLKO.1 151 CDS 100% 4.950 3.465 N METTL25 n/a
3 TRCN0000168573 GCTGATACTGAGGAAGTGTTT pLKO.1 832 CDS 100% 4.950 3.465 N METTL25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09156 pDONR223 100% 72% 72% None (many diffs) n/a
2 ccsbBroad304_09156 pLX_304 0% 72% 72% V5 (many diffs) n/a
3 TRCN0000472945 CCCTTGTTACGGGATAATCAATTC pLX_317 19.2% 72% 72% V5 (many diffs) n/a
Download CSV