Transcript: Human XM_005269386.2

PREDICTED: Homo sapiens mitochondrial calcium uptake 1 (MICU1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MICU1 (10367)
Length:
1932
CDS:
331..1077

Additional Resources:

NCBI RefSeq record:
XM_005269386.2
NBCI Gene record:
MICU1 (10367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053370 GCAATGGCGAACTGAGCAATA pLKO.1 917 CDS 100% 10.800 7.560 N MICU1 n/a
2 TRCN0000299804 GCAATGGCGAACTGAGCAATA pLKO_005 917 CDS 100% 10.800 7.560 N MICU1 n/a
3 TRCN0000053372 CTTCGCTTTACCCAAACAGTA pLKO.1 1056 CDS 100% 4.950 3.465 N MICU1 n/a
4 TRCN0000053368 GCAGCTCAAGAAGCACTTCAA pLKO.1 687 CDS 100% 4.950 3.465 N MICU1 n/a
5 TRCN0000299805 GCAGCTCAAGAAGCACTTCAA pLKO_005 687 CDS 100% 4.950 3.465 N MICU1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02410 pDONR223 100% 52.1% 52.1% None 0_1ins684 n/a
2 ccsbBroad304_02410 pLX_304 0% 52.1% 52.1% V5 0_1ins684 n/a
3 TRCN0000481335 GGATATCGAACGTTACCCATTGAG pLX_317 30.3% 52.1% 52.1% V5 0_1ins684 n/a
Download CSV