Transcript: Human XM_005269891.3

PREDICTED: Homo sapiens carbohydrate sulfotransferase 15 (CHST15), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST15 (51363)
Length:
4891
CDS:
730..2415

Additional Resources:

NCBI RefSeq record:
XM_005269891.3
NBCI Gene record:
CHST15 (51363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154727 GAGAGGTTGTACTCAGACTAT pLKO.1 1915 CDS 100% 4.950 3.465 N CHST15 n/a
2 TRCN0000280696 GAGAGGTTGTACTCAGACTAT pLKO_005 1915 CDS 100% 4.950 3.465 N CHST15 n/a
3 TRCN0000157867 CGTCAAGTACACCATGCACAA pLKO.1 2181 CDS 100% 4.050 2.835 N CHST15 n/a
4 TRCN0000280632 CGTCAAGTACACCATGCACAA pLKO_005 2181 CDS 100% 4.050 2.835 N CHST15 n/a
5 TRCN0000155609 CAACAGCATCACAACTAGGAT pLKO.1 1197 CDS 100% 3.000 2.100 N CHST15 n/a
6 TRCN0000280631 CAACAGCATCACAACTAGGAT pLKO_005 1197 CDS 100% 3.000 2.100 N CHST15 n/a
7 TRCN0000156858 GCAGATGAACTTGCTTGCTGT pLKO.1 879 CDS 100% 2.640 1.848 N CHST15 n/a
8 TRCN0000152136 CCAAAGCAAATTGGAGCATTT pLKO.1 4686 3UTR 100% 10.800 6.480 N CHST15 n/a
9 TRCN0000297882 CCAAAGCAAATTGGAGCATTT pLKO_005 4686 3UTR 100% 10.800 6.480 N CHST15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03289 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03289 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473728 ATTGCACAACAAGCTCGTGCAGCC pLX_317 27.2% 100% 100% V5 n/a
Download CSV