Transcript: Human XM_005269894.5

PREDICTED: Homo sapiens carbohydrate sulfotransferase 15 (CHST15), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST15 (51363)
Length:
2759
CDS:
729..2234

Additional Resources:

NCBI RefSeq record:
XM_005269894.5
NBCI Gene record:
CHST15 (51363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269894.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154727 GAGAGGTTGTACTCAGACTAT pLKO.1 1914 CDS 100% 4.950 3.465 N CHST15 n/a
2 TRCN0000280696 GAGAGGTTGTACTCAGACTAT pLKO_005 1914 CDS 100% 4.950 3.465 N CHST15 n/a
3 TRCN0000157867 CGTCAAGTACACCATGCACAA pLKO.1 2180 CDS 100% 4.050 2.835 N CHST15 n/a
4 TRCN0000280632 CGTCAAGTACACCATGCACAA pLKO_005 2180 CDS 100% 4.050 2.835 N CHST15 n/a
5 TRCN0000155609 CAACAGCATCACAACTAGGAT pLKO.1 1196 CDS 100% 3.000 2.100 N CHST15 n/a
6 TRCN0000280631 CAACAGCATCACAACTAGGAT pLKO_005 1196 CDS 100% 3.000 2.100 N CHST15 n/a
7 TRCN0000156858 GCAGATGAACTTGCTTGCTGT pLKO.1 878 CDS 100% 2.640 1.848 N CHST15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269894.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03289 pDONR223 100% 88.9% 88.9% None 1496_1499delATTTinsGGC;1503_1503delCins182 n/a
2 ccsbBroad304_03289 pLX_304 0% 88.9% 88.9% V5 1496_1499delATTTinsGGC;1503_1503delCins182 n/a
3 TRCN0000473728 ATTGCACAACAAGCTCGTGCAGCC pLX_317 27.2% 88.9% 88.9% V5 1496_1499delATTTinsGGC;1503_1503delCins182 n/a
Download CSV