Transcript: Human XM_005270287.2

PREDICTED: Homo sapiens BCL2 associated athanogene 3 (BAG3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAG3 (9531)
Length:
2558
CDS:
297..2021

Additional Resources:

NCBI RefSeq record:
XM_005270287.2
NBCI Gene record:
BAG3 (9531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293299 ACATCTCCATTCCGGTGATAC pLKO_005 910 CDS 100% 10.800 15.120 N BAG3 n/a
2 TRCN0000293370 TCAATTACCCATCACATAAAT pLKO_005 2360 3UTR 100% 15.000 10.500 N BAG3 n/a
3 TRCN0000293333 ACCTGATGATCGAAGAGTATT pLKO_005 1645 CDS 100% 13.200 9.240 N BAG3 n/a
4 TRCN0000294937 ACCTGATGATCGAAGAGTATT pLKO_005 1645 CDS 100% 13.200 9.240 N Bag3 n/a
5 TRCN0000007293 CCTGGACACATCCCAATTCAA pLKO.1 1293 CDS 100% 5.625 3.938 N BAG3 n/a
6 TRCN0000007294 CTTGAACAGAAAGCCATTGAT pLKO.1 1773 CDS 100% 5.625 3.938 N BAG3 n/a
7 TRCN0000293298 CTTGAACAGAAAGCCATTGAT pLKO_005 1773 CDS 100% 5.625 3.938 N BAG3 n/a
8 TRCN0000007292 GAAGGCAAGAAGACTGACAAA pLKO.1 1620 CDS 100% 4.950 3.465 N BAG3 n/a
9 TRCN0000293372 GAAGGCAAGAAGACTGACAAA pLKO_005 1620 CDS 100% 4.950 3.465 N BAG3 n/a
10 TRCN0000007291 CCAATTCAAGTGATCCGCAAA pLKO.1 1305 CDS 100% 4.050 2.835 N BAG3 n/a
11 TRCN0000007290 GCATGCATTTCAGAGACTTTA pLKO.1 2080 3UTR 100% 13.200 7.920 N BAG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15670 pDONR223 0% 99.7% 99.8% None 906_907insCAG;1293A>G n/a
2 ccsbBroad304_15670 pLX_304 0% 99.7% 99.8% V5 906_907insCAG;1293A>G n/a
Download CSV