Transcript: Human XM_005270785.4

PREDICTED: Homo sapiens glutathione S-transferase mu 5 (GSTM5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTM5 (2949)
Length:
1305
CDS:
125..469

Additional Resources:

NCBI RefSeq record:
XM_005270785.4
NBCI Gene record:
GSTM5 (2949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270785.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148649 CCTGCCATGTCTTGTCTTATT pLKO.1 882 3UTR 100% 13.200 18.480 N GSTM5 n/a
2 TRCN0000414042 CTCAGGACTGTGCTCGAATTG pLKO_005 920 3UTR 100% 10.800 8.640 N GSTM5 n/a
3 TRCN0000432767 CAGCTACATGGAACAGCAAAT pLKO_005 447 CDS 100% 10.800 7.560 N GSTM5 n/a
4 TRCN0000146884 CCTAAACTTGAAGGACTTCAT pLKO.1 346 CDS 100% 4.950 3.465 N GSTM5 n/a
5 TRCN0000149129 GAAGCGTATATTTGAGCCCAA pLKO.1 310 CDS 100% 2.160 1.512 N GSTM5 n/a
6 TRCN0000149670 GAACCAGGTTATGGATAACCA pLKO.1 115 5UTR 100% 0.300 0.210 N GSTM5 n/a
7 TRCN0000147094 CCTTGACATGAAGCGTATATT pLKO.1 301 CDS 100% 15.000 9.000 N GSTM5 n/a
8 TRCN0000425811 ACTGTGCTATGACCCAGATTT pLKO_005 151 CDS 100% 13.200 7.920 N GSTM5 n/a
9 TRCN0000420215 AGAAGATTCGTGTGGACATTT pLKO_005 90 5UTR 100% 13.200 6.600 Y GSTM1 n/a
10 TRCN0000252919 AGATCACCTTTGTGGATTTCA pLKO_005 267 CDS 100% 5.625 2.813 Y Gstm7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270785.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06334 pDONR223 100% 52.2% 52.2% None 0_1ins312 n/a
2 ccsbBroad304_06334 pLX_304 0% 52.2% 52.2% V5 0_1ins312 n/a
3 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 52.2% 52.2% V5 0_1ins312 n/a
Download CSV