Transcript: Human XM_005271419.4

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 15 (ADAMTS15), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS15 (170689)
Length:
4961
CDS:
278..2137

Additional Resources:

NCBI RefSeq record:
XM_005271419.4
NBCI Gene record:
ADAMTS15 (170689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046763 GCGCGGTTACAAAGGGCTGAT pLKO.1 1423 CDS 100% 1.350 1.890 N ADAMTS15 n/a
2 TRCN0000424137 GCCCATGCATGGCTACAATTT pLKO_005 1357 CDS 100% 13.200 9.240 N ADAMTS15 n/a
3 TRCN0000412586 TGGATGGTTCCTGGGCCAAAT pLKO_005 828 CDS 100% 10.800 7.560 N ADAMTS15 n/a
4 TRCN0000046765 CTCCAAGAAGAGATTCGACAA pLKO.1 1276 CDS 100% 4.050 2.835 N ADAMTS15 n/a
5 TRCN0000046766 GCCCTGTCCTTACATGCAGTA pLKO.1 655 CDS 100% 4.050 2.835 N ADAMTS15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05159 pDONR223 100% 65.1% 65.1% None 0_1ins993 n/a
2 ccsbBroad304_05159 pLX_304 0% 65.1% 65.1% V5 0_1ins993 n/a
3 TRCN0000467885 CTCGTCCTAAACGAACAAAACCCT pLX_317 14.1% 65.1% 65.1% V5 0_1ins993 n/a
Download CSV