Transcript: Human XM_005271709.4

PREDICTED: Homo sapiens transforming growth factor beta regulator 1 (TBRG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBRG1 (84897)
Length:
4719
CDS:
239..1033

Additional Resources:

NCBI RefSeq record:
XM_005271709.4
NBCI Gene record:
TBRG1 (84897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373593 CTATTGCAGTACTCGAATATA pLKO_005 442 CDS 100% 15.000 21.000 N TBRG1 n/a
2 TRCN0000373592 ATCTTGTAATCGGGATGTAAT pLKO_005 1247 3UTR 100% 13.200 18.480 N TBRG1 n/a
3 TRCN0000307585 CAATTACCAGTGGGTGAAATT pLKO_005 742 CDS 100% 13.200 9.240 N Tbrg1 n/a
4 TRCN0000016914 CCAGACCAGAAGTGTCTATAT pLKO.1 479 CDS 100% 13.200 9.240 N TBRG1 n/a
5 TRCN0000016916 GCAGATGCTTGTCATGCAGAA pLKO.1 587 CDS 100% 4.050 2.835 N TBRG1 n/a
6 TRCN0000016913 CCCATGTACCTGACACATGAA pLKO.1 941 CDS 100% 0.495 0.347 N TBRG1 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2877 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2878 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12875 pDONR223 100% 70.8% 70.8% None 1_231del n/a
2 ccsbBroad304_12875 pLX_304 0% 70.8% 70.8% V5 1_231del n/a
Download CSV