Transcript: Human XM_005271745.4

PREDICTED: Homo sapiens dopa decarboxylase (DDC), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDC (1644)
Length:
1959
CDS:
205..1533

Additional Resources:

NCBI RefSeq record:
XM_005271745.4
NBCI Gene record:
DDC (1644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271745.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335912 TGGAAAGAGCTGGGTTAATTG pLKO_005 674 CDS 100% 13.200 18.480 N DDC n/a
2 TRCN0000005527 CGACGTTGAGAAGATAATCAT pLKO.1 378 CDS 100% 5.625 7.875 N DDC n/a
3 TRCN0000335825 CGACGTTGAGAAGATAATCAT pLKO_005 378 CDS 100% 5.625 7.875 N DDC n/a
4 TRCN0000335827 TTGCAGATTCATTCAACTTTA pLKO_005 968 CDS 100% 13.200 9.240 N DDC n/a
5 TRCN0000335828 GCTTGTCTGCTTTCGGCTAAA pLKO_005 1311 CDS 100% 10.800 7.560 N DDC n/a
6 TRCN0000005524 GCTTAGTATCTCATCAACAAA pLKO.1 1690 3UTR 100% 5.625 3.938 N DDC n/a
7 TRCN0000335909 GCTTAGTATCTCATCAACAAA pLKO_005 1690 3UTR 100% 5.625 3.938 N DDC n/a
8 TRCN0000005525 GCCAACTACATGGAAGGCATT pLKO.1 256 CDS 100% 4.050 2.835 N DDC n/a
9 TRCN0000005526 GCAAAGAATAAACAGTGCCAA pLKO.1 1362 CDS 100% 2.640 1.848 N DDC n/a
10 TRCN0000005528 GCTGGCCTGATTCCTTTCTTT pLKO.1 784 CDS 100% 5.625 3.375 N DDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271745.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.