Transcript: Human XM_005271867.5

PREDICTED: Homo sapiens chromodomain helicase DNA binding protein 1 (CHD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHD1 (1105)
Length:
7691
CDS:
1383..6515

Additional Resources:

NCBI RefSeq record:
XM_005271867.5
NBCI Gene record:
CHD1 (1105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271867.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359226 CAAATAGTGGAACGTATAATT pLKO_005 2547 CDS 100% 15.000 21.000 N CHD1 n/a
2 TRCN0000234342 TGATGAAGCACACCGATTAAA pLKO_005 3221 CDS 100% 15.000 21.000 N CHD1 n/a
3 TRCN0000359159 AGGGTCCAACATTCCGAATAT pLKO_005 4975 CDS 100% 13.200 18.480 N CHD1 n/a
4 TRCN0000021309 GCGGTTTATCAAGAGCTATAA pLKO.1 4778 CDS 100% 13.200 18.480 N CHD1 n/a
5 TRCN0000096528 CGTGCAGACTACCTCATCAAA pLKO.1 5295 CDS 100% 5.625 7.875 N Chd1 n/a
6 TRCN0000021311 GCGCAGTAGAAGTAGGAGATA pLKO.1 4646 CDS 100% 4.950 6.930 N CHD1 n/a
7 TRCN0000096527 CCATCCTATATTGGAGGACAT pLKO.1 2790 CDS 100% 4.050 5.670 N Chd1 n/a
8 TRCN0000021313 CCATCGTGATTGGGATCACTA pLKO.1 6134 CDS 100% 0.495 0.693 N CHD1 n/a
9 TRCN0000234343 CAAGCAAGACAGCAGATATTA pLKO_005 6155 CDS 100% 15.000 10.500 N CHD1 n/a
10 TRCN0000234345 CCAGGATGCAAGGTCTATTAT pLKO_005 6645 3UTR 100% 15.000 10.500 N CHD1 n/a
11 TRCN0000234344 CTGAATATACGCACCATAAAT pLKO_005 6322 CDS 100% 15.000 10.500 N CHD1 n/a
12 TRCN0000359156 TTTAGACTGACCTCCATTTAA pLKO_005 6839 3UTR 100% 15.000 10.500 N CHD1 n/a
13 TRCN0000218236 AGCATGCATTGATGAGTATTT pLKO_005 2684 CDS 100% 13.200 9.240 N CHD1 n/a
14 TRCN0000359227 CAGTACCATGATCATCATAAA pLKO_005 6036 CDS 100% 13.200 9.240 N CHD1 n/a
15 TRCN0000359158 CATAAACCAACACAGTAATTG pLKO_005 6563 3UTR 100% 13.200 9.240 N CHD1 n/a
16 TRCN0000021312 GCAGTTGTGATGAAACAGAAT pLKO.1 1900 CDS 100% 4.950 3.465 N CHD1 n/a
17 TRCN0000021310 CCACTCTTACTTCCTGGCAAA pLKO.1 3001 CDS 100% 4.050 2.835 N CHD1 n/a
18 TRCN0000159276 GAAGAAGAAGAAAGACAAAGA pLKO.1 4548 CDS 100% 4.950 2.475 Y C1orf35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271867.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10732 pDONR223 100% 99.9% 99.9% None 4335G>A;5048_5050delCTC n/a
2 ccsbBroad304_10732 pLX_304 0% 99.9% 99.9% V5 4335G>A;5048_5050delCTC n/a
3 TRCN0000478855 TATACTCCTCCAAGGTGGACAACT pLX_317 7.3% 99.9% 99.9% V5 4335G>A;5048_5050delCTC n/a
Download CSV