Transcript: Human XM_005272608.3

PREDICTED: Homo sapiens monoamine oxidase B (MAOB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAOB (4129)
Length:
2695
CDS:
325..1839

Additional Resources:

NCBI RefSeq record:
XM_005272608.3
NBCI Gene record:
MAOB (4129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378600 GCGTCTGATCCACCATGTAAA pLKO_005 534 CDS 100% 13.200 18.480 N MAOB n/a
2 TRCN0000046022 GATTGGATTGACCACCATCTT pLKO.1 1761 CDS 100% 4.950 6.930 N MAOB n/a
3 TRCN0000358682 ATTACCTACTTAGATCATAAC pLKO_005 604 CDS 100% 10.800 7.560 N MAOB n/a
4 TRCN0000358606 GTCCTTGTGGAGACCCTAAAC pLKO_005 1009 CDS 100% 10.800 7.560 N MAOB n/a
5 TRCN0000363180 TAGGATTGGAGACCTACAAAG pLKO_005 500 CDS 100% 10.800 7.560 N MAOB n/a
6 TRCN0000046020 GCCAGTGGACAGGATTTACTT pLKO.1 1524 CDS 100% 5.625 3.938 N MAOB n/a
7 TRCN0000046019 CCCAGAATCGTATCTTGAGAT pLKO.1 467 CDS 100% 4.950 3.465 N MAOB n/a
8 TRCN0000046018 CCATGAGATGTATGAGGCTAA pLKO.1 1029 CDS 100% 4.050 2.835 N MAOB n/a
9 TRCN0000046021 CCAATTACCTACTTAGATCAT pLKO.1 601 CDS 100% 4.950 2.970 N MAOB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06558 pDONR223 100% 96.7% 96.5% None 0_1ins48;65G>A;341C>A n/a
2 ccsbBroad304_06558 pLX_304 0% 96.7% 96.5% V5 0_1ins48;65G>A;341C>A n/a
3 TRCN0000472471 AGAGGTACCCTTCCATCGGTGAAG pLX_317 32.5% 96.7% 96.5% V5 0_1ins48;65G>A;341C>A n/a
Download CSV