Transcript: Human XM_005273052.1

PREDICTED: Homo sapiens spermatogenesis associated 17 (SPATA17), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA17 (128153)
Length:
1398
CDS:
38..1123

Additional Resources:

NCBI RefSeq record:
XM_005273052.1
NBCI Gene record:
SPATA17 (128153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242802 CCGAGATATCACCGAAGTATT pLKO_005 769 CDS 100% 13.200 18.480 N SPATA17 n/a
2 TRCN0000167685 GCAGGTAGCATATTATACTAT pLKO.1 274 CDS 100% 5.625 7.875 N SPATA17 n/a
3 TRCN0000242804 ATGTCAAGTTCGGGCATATAT pLKO_005 172 CDS 100% 15.000 10.500 N SPATA17 n/a
4 TRCN0000242803 TGAAATTCTACCACCTATTAA pLKO_005 724 CDS 100% 15.000 10.500 N SPATA17 n/a
5 TRCN0000242800 CAGACTGTATTACCATCATTT pLKO_005 1049 CDS 100% 13.200 9.240 N SPATA17 n/a
6 TRCN0000242801 TAACTGTGCAGGTAGCATATT pLKO_005 267 CDS 100% 13.200 7.920 N SPATA17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04835 pDONR223 100% 99.9% 100% None 582G>A n/a
2 ccsbBroad304_04835 pLX_304 0% 99.9% 100% V5 582G>A n/a
3 TRCN0000473251 ATTGTCGATTTCGCCATGACTACC pLX_317 48.3% 99.9% 100% V5 582G>A n/a
Download CSV