Transcript: Human XM_005273125.3

PREDICTED: Homo sapiens lamin B receptor (LBR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LBR (3930)
Length:
3650
CDS:
128..1849

Additional Resources:

NCBI RefSeq record:
XM_005273125.3
NBCI Gene record:
LBR (3930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344877 AGCGTGTGCCCTACCGTATAT pLKO_005 1812 CDS 100% 13.200 18.480 N LBR n/a
2 TRCN0000060462 CCATTCATACTTCAACGGGAA pLKO.1 1575 CDS 100% 2.160 3.024 N LBR n/a
3 TRCN0000333589 CCATTCATACTTCAACGGGAA pLKO_005 1575 CDS 100% 2.160 3.024 N LBR n/a
4 TRCN0000359440 ATAGCCGTGTTTACTTGTATT pLKO_005 2011 3UTR 100% 13.200 10.560 N LBR n/a
5 TRCN0000353099 TTCCCACCAGGCCGACATTAA pLKO_005 427 CDS 100% 13.200 10.560 N LBR n/a
6 TRCN0000060459 CGCCTCTTATTGATGGAAGAA pLKO.1 978 CDS 100% 4.950 3.960 N LBR n/a
7 TRCN0000060460 GCCTGAGCATATTGAGAGAAA pLKO.1 532 CDS 100% 4.950 3.960 N LBR n/a
8 TRCN0000333665 GCCTGAGCATATTGAGAGAAA pLKO_005 532 CDS 100% 4.950 3.960 N LBR n/a
9 TRCN0000359517 TGCAATTCCAGCTGCCATTTG pLKO_005 1880 3UTR 100% 10.800 7.560 N LBR n/a
10 TRCN0000060458 CCGTGAATTAAACCCTCGAAT pLKO.1 1240 CDS 100% 4.950 3.465 N LBR n/a
11 TRCN0000060461 CGAGGTGCAAATTCTCAGAAA pLKO.1 1505 CDS 100% 4.950 3.465 N LBR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00929 pDONR223 100% 93.1% 93.1% None 1187_1188ins126 n/a
2 ccsbBroad304_00929 pLX_304 0% 93.1% 93.1% V5 1187_1188ins126 n/a
3 TRCN0000474236 AGACTTTATTTAAGTCTTCTAAAG pLX_317 28.9% 93.1% 93.1% V5 1187_1188ins126 n/a
Download CSV